Sol Genomics Network

Unigene SGN-U581240

Unigene Basic Information

Unigene ID:	SGN-U581240
Unigene Build:	Tomato 200607 #2
Date:	2009-03-25
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	none
mRNA sequence:	Length: 1119 bp

>SGN-U581240 Tomato 200607 #2 (734 members)
ATAGGGCGATTGGCGGCCAATCGGCCGAATTGCTTCTCGAGCCTTCACTGGTGCGTCGTTTTCTTCCTCTCTCTTCCAATCAACCCTAAC
TTTAGAGAGAGAAAGAAAAAGGCTACTCTTCCACCATGTTGGTTTATCAGGATCTCCTCACCGGTGATGAGCTTCTCTCTGACTCATTTC
CCTACAAAGAAGTCGAGAATGGCGTGCTTTGGGAAGTTCAAGGGAAGTGGGTTGTTCAAGGTGCCGTCGATGTAAACATTGGGGCAAATC
CTTCTGCTGAGGGTGGATGTGAAGATGAAGGTGTGGATGACCAAGCTGTCAGGGTTGTCGATATTGTTGACACTTTTAGACTTCAGGAGC
AACCTGCTTTTGACAAGAAACAATTTGTTACCTTCATGAAGAGATACATCAAGAACCTGACACCCAAGCTAGAAGGAGAAACACAAGAAG
CATTTAAAAAGAACATTGAAGCAGCAACTAAGTTTCTTTTGCAAAAGATCAAGGACTTGCAATTCTTTGTTGGTGAGAGCATGCATGATG
ATGGCGCCCTGGTGTTTGCGTACTACAAGGAGGGTTCAGCTGATCCTACCTTTTTGTACATTGCACCTGGTTTGAAGGAGATCAAGTGCT
AGATGTCTGGTGGAGTGCTTCTGCTAGAAGTTTTGCATTCGAGATTATGTTTCATGTAGTTTTTAATATTTGGTCTTTTTTGCTTATTTA
TGTCTGGTGTTTCTTCTAAACCTTGGGTACTTGCTGTAACCAGTACGGCAGTACCTGCAGTTTTTCTTTATCATATGATCTTATTATGTG
GGACAGCAAATGGTTAGCTGATTGAATTGGAAGTGTTCTGATTAACAATTTTGCCTATTTGATCTTTTAAAACAAATTTGATATGTTGCC
TGAAAAAAAAGTCGAGGACGGGCCTGTCCCCGAGTTCACCTCATAAGGAGCCAAATAAATGGTGCATGCTCTACCTACTTCTAAGTATGC
TGTAGTAATTCTTTGCTTCCAATTCAATTCAGTATATCACAAAAACGAAACGAAGAATTTTCTTCATGTTCTAAGTAAAATTGTAATTTC
AACTTCGCACACAATCATATTGTATACATATTTTCCTAC

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
TOMTRALTAI	meloidogyne-induced giant cell protein DB141

Genomic locations (0)

None

Library representation (46)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPP	pollen pollen collected from open flowers	5426	4
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	19
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	91
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	67
Solanum lycopersicum	LE15	Fruit 15 days post anthesis	269	1
Solanum lycopersicum	Le2TR	roots 1-,2-,3-, and 4- month-old	1179	8
Solanum lycopersicum	LeCAD	Seedling Two-week-old seedings	428	1
Solanum lycopersicum	LeMiToFr02	fruit	18697	10
Solanum lycopersicum	LeMiToLf01	leaf	30679	21
Solanum lycopersicum	LePS	root 5 weeks old plants	823	2
Solanum lycopersicum	LePU	Pericarp Turning stage of fruit ripening.	1542	1
Solanum lycopersicum	LeTransC5	Root 1.5-month old plants	561	2
Solanum lycopersicum	LeTrich01	Isolated leaf trichomes Apical internodes of 5-week old plants.	7299	1
Solanum lycopersicum	Sl_FruitQTL	late maturation (breaker and red ripe)	663	6
Solanum lycopersicum	Sl_LeafInf01	Developmental stage	125	3
Solanum lycopersicum	Sl_RootSSH01	root	123	1
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	9
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	4
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	17
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	18
Solanum lycopersicum	cLEE	seeds and maturing carpels 5 days post-anthesis to fruit over-ripe stage	547	1
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	40
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	42
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	20
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	35
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	11
Solanum lycopersicum	cLEN	fruit pericarp red ripe to over-ripe	3979	15
Solanum lycopersicum	cLER	leaf 4 weeks	5127	4
Solanum lycopersicum	cLES	leaf 4 weeks	5243	19
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	38
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	4
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	31
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	15
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	10
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	10
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	18
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	33
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	4
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	24
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	36
Solanum lycopersicum	cTOS	suspension cultures	8026	21
Solanum lycopersicum	cTSB	seed	1880	1
Solanum lycopersicum	cTSC	seed	2256	3
Solanum lycopersicum	cTSD	seed	1504	4
Solanum lycopersicum	t3_tus	Rearrayed collection of L. esculentum cDNA clones	1883	1
Solanum lycopersicum	vSlycmRNA		8362	8

mRNA member sequences (734)

Alignment image suppressed for unigene with 734 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (4)

Annotations (manual: 3 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (0)

None

Preceding Unigenes (9)

Unigene	Build
SGN-U314338	Tomato 200607 #1
SGN-U314897	Tomato 200607 #1
SGN-U314898	Tomato 200607 #1
SGN-U314911	Tomato 200607 #1
SGN-U314912	Tomato 200607 #1
SGN-U338584	Tomato 200607 #1
SGN-U338585	Tomato 200607 #1
SGN-U338586	Tomato 200607 #1
SGN-U339164	Tomato 200607 #1

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: