Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U579951 in the current build, Tomato 200607 #2

Unigene SGN-U312717

Unigene Basic Information

Unigene ID:	SGN-U312717
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	312717
mRNA sequence:	Length: 1008 bp

>SGN-U312717 Tomato 200607 #1 (74 members)
ACAAAAAAAGCTCTGCCGCTCTCTCTCTTGAAGGAGTTTTCTTCTCATACTTTCGACAATGGCTTTACCAAACCAACAAACTGTAGATTA
TCCAAGCTTCAAGCTTGTTATTGTGGGGGATGGAGGAACTGGGAAGACAACTTTTGTCAAAAGGCATCTCACTGGTGAATTCGAGAAAAA
ATATGAACCCACTATTGGTGTGGAGGTTCATCCACTAGACTTCTTCACAAATTGTGGGAAAATTCGCTTTTATTGCTGGGATACAGCCGG
ACAAGAGAAGTTTGGAGGTCTCAGAGATGGTTACTACATTCATGGGCAATGTGCAATTATCATGTTTGATGTTACAGCCCGTCTGACCTA
CAAGAATGTTCCTACTTGGCATAGAGATCTTTGCAGGGTTTGTGAAAACATCCCCATTGTTCTCTGTGGAAACAAAGTTGATGTCAAGAA
CAGGCAGGTTAAGGCAAAGCAAGTTACCTTCCACAGGAAGAAAAATTTGCAGTACTATGAGATCTCGGCAAAGAGTAACTATAACTTTGA
GAAGCCTTTTCTGTACCTTGCTAGAAAGCTTGCTGGGGATGGTAATCTTCACTTTGTGGAATCACCTGCACTTGCTCCCCCAGAAGTACA
AATTGACTTAGCTGCACAGGCCCTGCACGAACAGGAGCTTCAAGCAGCCCTTAATCAGCCACTTCCAGATGACGATGATGAAGCATTTGA
ATAGATGGCATAGCTCAGAGCAGATCAGTTTCACTGTTGCACCTTTCCATATTCCTAGTCCTTCAATTTTCTCTATTTGGGCTTTTTTTG
TCTTTGTTGTTTGAGGATGTATTTGCTGCTTCCTTGTATTATTGATTGGTTAGTAGATGTATTCGTCTGGGGCCATGAGGTTTTGTTTTG
TTAGGTTAGATATTCCCATCCTGATATATGGGCGCACATTGTCGAGGCTCTGTTTTGAGCTTGTTATAATATTACTTGGTCTCATATTCG
ACAGTAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
ran2a	Ran protein/TC4 protein ran2a

Genomic locations (0)

None

Library representation (26)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	10
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	3
Solanum lycopersicum	LB	Leaf Mature leaves	3316	1
Solanum lycopersicum	LC	Leaf Mature leaves	5712	1
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	1
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	5
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	1
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	8
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	1
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	2
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	5
Solanum lycopersicum	cLEN	fruit pericarp red ripe to over-ripe	3979	5
Solanum lycopersicum	cLES	leaf 4 weeks	5243	2
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	2
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	1
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	3
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	1
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	5
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	1
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	1
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	3
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	5
Solanum lycopersicum	cTOS	suspension cultures	8026	2
Solanum lycopersicum	cTSB	seed	1880	2
Solanum lycopersicum	t3_tus	Rearrayed collection of L. esculentum cDNA clones	1883	1
Solanum lycopersicum	vSlycmRNA		8362	2

mRNA member sequences (74)

Alignment image suppressed for unigene with 74 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 6 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101377	Ras GTPase - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264)	504
2	118418	Ras Ras GTPase - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264)	280
5	129498	GTP-binding nuclear protein Ran - Cellular Component: exosome (RNase complex) (GO:0000178) - Molecular Function: GTP binding (GO:0005525) - Biological Process: intracellular protein transport (GO:0006886) Small GTP-binding protein domain - Molecular Function: GTP binding (GO:0005525) Ras Ras GTPase - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264)	20

Preceding Unigenes (1)

Unigene	Build
SGN-U212977	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: