Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U577367, SGN-U581364, SGN-U592929, and SGN-U593580 in the current build, Tomato 200607 #2

Unigene SGN-U312700

Unigene Basic Information

Unigene ID:	SGN-U312700
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	312700
mRNA sequence:	Length: 1182 bp

>SGN-U312700 Tomato 200607 #1 (126 members)
TTGCACTGACCACTCAGCACAAAGAAAGCAAAAAAAAAAAAAGAAGAAGAAAAAAGCTTCAATCTTTGTGAAAAAATGGCAGAAAACAAG
GAAGAAGATGTTAAGCTTGGAGCTAACAAGTTTAGGGAAACTCAACCATTAGGTACAGCAGCTCAAACAGACAAAGATTACAAAGAGCCA
CCACCAGCTCCATTGTTTGAACCAGGGGAGTTGTCATCATGGTCCTTTTACAGGGCTGGTATTGCAGAGTTCATGGCAACTTTCTTGTTC
TTGTATATCACAATCTTGACTGTTATGGGTCTTAAGAGATCTGATAGTTTATGTTCTTCAGTGGGTATTCAAGGGGTTGCTTGGGCTTTT
GGTGGTATGATCTTTGCTTTGGTCTACTGTACTGCTGGTATCTCAGGAGGACACATCAACCCAGCTGTGACCTTTGGTCTTTTCTTGGCA
AGGAAATTGTCCTTGACCAGGGCTGTTTTCTACATGGTGATGCAGTGCCTTGGTGCAATCTGTGGTGCTGGTGTTGTGAAGGGCTTCATG
GTAGGACCATACCAAAGACTTGGTGGTGGTGCTAATGTTGTTAACCCTGGATACACCAAGGGTGATGGCCTTGGTGCTGAAATTATTGGC
ACCTTTGTCCTTGTTTACACTGTTTTTTCAGCCACTGATGCCAAGAGAAATGCCAGAGACTCACATGTTCCTATTTTGGCACCACTTCCT
ATTGGATTCGCAGTGTTCTTGGTTCATTTGGCCACCATCCCCATCACCGGAACTGGCATCAACCCCGCCAGGAGTCTTGGAGCTGCTATC
ATCTACAACGACGAGCATGCATGGAATGACCACTGGATCTTCTGGGTTGGACCAATGATTGGAGCTGCTCTTGCTGCTATTTACCACCAA
ATAATTATCAGAGCTATGCCATTCCACAGGTCTTAAGTTATCTGTCTTTAAACAATGGGATTCTCAAAGACTCAACAGTGTACTTTTGTC
TTCTTTTTTTGGGGGGTTGAATGTTCAAGTTTCTCCTTCAATGTATTTGTAATGTGGATCTGTTCCTTCTGTTAAGATGTTCTATTATGT
GTGTAAATTATCAGGTTATGATAATGTAATGTACCTTATCAATGAAGGTTCTTTATTTTTATCTTTGAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
SlPIP1.5	plasma membrane intrinsic protein 1.5	water channel protein

Genomic locations (0)

None

Library representation (29)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPT	leaf trichomes 4-8 weeks old	2729	1
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	25
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	6
Solanum lycopersicum	LB	Leaf Mature leaves	3316	2
Solanum lycopersicum	LC	Leaf Mature leaves	5712	1
Solanum lycopersicum	LE08	Fruit 8 days post anthesis	339	1
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	7
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	1
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	4
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	3
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	6
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	3
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	2
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	1
Solanum lycopersicum	cLEN	fruit pericarp red ripe to over-ripe	3979	2
Solanum lycopersicum	cLER	leaf 4 weeks	5127	1
Solanum lycopersicum	cLES	leaf 4 weeks	5243	3
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	9
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	3
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	9
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	4
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	5
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	1
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	6
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	1
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	8
Solanum lycopersicum	cTOS	suspension cultures	8026	4
Solanum habrochaites	LH_Ea	Glandular Trichomes	3840	5
Solanum habrochaites	cLHT	leaf trichomes 4-8 weeks old	2457	2

mRNA member sequences (126)

Alignment image suppressed for unigene with 126 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (3)

Annotations (manual: 2 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101425	Major intrinsic protein - Molecular Function: transporter activity (GO:0005215) - Biological Process: transport (GO:0006810) - Cellular Component: membrane (GO:0016020)	199
2	118438	Major intrinsic protein - Molecular Function: transporter activity (GO:0005215) - Biological Process: transport (GO:0006810) - Cellular Component: membrane (GO:0016020)	168
5	128978	Aquaporin - Molecular Function: transporter activity (GO:0005215) - Biological Process: transport (GO:0006810) - Cellular Component: integral to membrane (GO:0016021) Major intrinsic protein - Molecular Function: transporter activity (GO:0005215) - Biological Process: transport (GO:0006810) - Cellular Component: membrane (GO:0016020)	87

Preceding Unigenes (2)

Unigene	Build
SGN-U212565	Lycopersicon Combined #3
SGN-U212568	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: