Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U578712 in the current build, Tomato 200607 #2

Unigene SGN-U312659

Unigene Basic Information

Unigene ID:	SGN-U312659
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	312659
mRNA sequence:	Length: 1245 bp

>SGN-U312659 Tomato 200607 #1 (73 members)
CCACTCCCCACTTCCCCCTCACGTCCGCCGGCGGAGGTTAATCGAGAAGAAACAATGGCCTTCATCAAAGTCCAGAAGACAAGGGCTTAT
TTTAAGCGTTTCCAGGTTAAATTCAAGAGAAGGAGAGAGGGGAAAACAGATTACAGAGCCAGGAATCGCTTGATCAATCAGGACAAAAAT
AAGTACAACACTCCTAAATATCGTTTGGTTGTCCGATTTACTAACAAGGACATAATTGCACAAATTGTGTCTGCTAGTATTGCTGGTGAC
ATGATTCTTGCCTCTGCTTATGCTAACGAGCTGCCTCGTTATGGCCTAGAAGTTGGACTGACTAATTATGCTGCTGCCTACTGCACTGGA
CTTCTTTTGGCAAGGAGAGTTCTTAAAAAGCTTGAAATGGATGAGGAGTATGAAGGGAACCTTGAGGTCAATGGGGAGGACTACTCTGTT
GAACCTGCTGAAAGCAGAAGGCCTTTCCGAGCTCTCTTGGATGTTGGCCTTCTAAGAACTACTACAGGAAATCGTGTTTTTGGTGCTCTC
AAGGGTGCATTGGATGGTGGACTTGATATTCCTCACAGTGAGAAGAGGTTCGCTGGATTCAGCAAGGATTCCAAGCAACTTGATGCTGAT
GTTCACCGCAAGTACATATATGGTGGCCACGTTGCTACATATATGCAGACTCTAATTGAAGATGAACCAGAGAAATATCAGACACACTTT
AGTCAGTACATCAAAAAGGGTTTTGAGGCTGATGGCCTTGAGGAGATGTACAAGAAGGTTCATGCTGCCATTCGTGCTGATCCAAGCCCA
AAGAAATCTGAGAAGCAACCTCCTAAACAGCACAAGAGGTATAATCTGAAGAAGCTAACATACGAGGAAAGGAAGGCTAAGTTGATTGAG
AGACTGAATGCTTTGAATTCAGCTGCTGGAAATGACGATGATGATGAGGATGACGAGTAAACAGCAGTGCAAGAGTCCTGAAATATTATT
GTTGCTTATGCTCTTTTTATACTCTGTTTTTTTCTTCTTTATTGAGATCTCAGTTTTGCATGCTCTGTAGAATGATAATTTACCAATTTG
AATGTCCTAAAATTTTATACTCAGCCTGATAAATCTGGCATGGAGTGTTGCATTATGTCACTTGCAAGGTAACCTTGCCTACTTATTATT
GCCTCGCCAATGGCAATGTGTTTGTAGCGTTAATGTCTAGGCAATTTCTTCACTAATTGATTCTAGCTGCTGGTA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (24)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPT	leaf trichomes 4-8 weeks old	2729	1
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	6
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	3
Solanum lycopersicum	LA	Leaf Mature leaves	6589	3
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	1
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	5
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	1
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	3
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	1
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	5
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	1
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	5
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	3
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	2
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	1
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	2
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	1
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	4
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	2
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	4
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	7
Solanum lycopersicum	cTOS	suspension cultures	8026	6
Solanum habrochaites	LH_Ea	Glandular Trichomes	3840	4
Solanum habrochaites	cLHT	leaf trichomes 4-8 weeks old	2457	2

mRNA member sequences (73)

Alignment image suppressed for unigene with 73 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 6 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101758	Zinc finger FYVE-type - Molecular Function: zinc ion binding (GO:0008270) Zinc finger FYVE/PHD-type - Molecular Function: zinc ion binding (GO:0008270)	40
2	119267	Ribosomal protein L18P/L5E - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Eukaryotic ribosomal protein L5 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) - Molecular Function: 5S rRNA binding (GO:0008097)	18
5	129613	Ribosomal protein L18P/L5E - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Eukaryotic ribosomal protein L5 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) - Molecular Function: 5S rRNA binding (GO:0008097)	18

Preceding Unigenes (1)

Unigene	Build
SGN-U212962	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: