Sol Genomics Network

Unigene SGN-U277027

Unigene Basic Information

Unigene ID:	SGN-U277027
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	277027
mRNA sequence:	Length: 656 bp

>SGN-U277027 Solanum tuberosum #4 (5 members)
AGTGGTTCAGCTCTGACAACACCTGTATATCCAACTCTAACTTTTTTTCTTGCATCCAAACCCCTTCTGCCAAATGGGTTTTAGGCTGCA
TCTCAAATGGGGTTTCTCTGTCCAACCCCCTTTCTCCTCCAATTCATCATCATGGCCTTCTTCACATTCTTTCAAAGGACGGGAGGCTTT
ATACGATCCAGCTAGGTCTCTTAAACCTTTTATAACTGGCGACTGTGAACCTTCACACAGTGATCCTTTCAGGGTGCAGACTTGTTTATC
TGACCCCCAACTGTGGACTAGTGATACATCAGTAACTACAGAAATAAAGACGCGAAATGGCAGAGGGTCCCCTAGCAATGCATATGGAGA
TATTGGCAGTCATAAGATTGGGATATCGCCTGACGGGGAGAAACCAACATATTTAAATACAACCAAATCTCTTCATTTTAGTTTACTAAT
GAAAAATCTTGATCTGCTGGAAAACATGTTTGCTGATTCAGAGATGTCAAGATTAGAAAGAGATATTTTGGTGCAACTAGAAAAGCTTGG
AGCTTTAGAATTCTTTCATACTTGTCTCTCAAGGACACAGCATTCTTCTACTTTTCCTAAGTTTCTTGATGTGCCAAGGGAGCTTATTAA
AGAAGTTGAGAAAGATGACCTTGTTG

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (3)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	STM	mixed tissues	14805	3
Solanum tuberosum	cSTA	Axillary buds of stemp explants; swelling stolons; growing stolons; growing sink-tubers 1 to 3 days (plates 1-20), 4 to 6 days (plates 21-40), 7 to 10 days (plates 41-60)	10537	1
Solanum tuberosum	cSTB	leaves and petioles 8 weeks old plants	10327	1

mRNA member sequences (5)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 1 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	627	Sigma70_r2 Sigma_70 Sigma70_r3 Sigma70_r4	29
2	30423		2
5	65290		2
1.1	101901	Sigma factor region 2 Sigma-70 region 3 - Molecular Function: DNA binding (GO:0003677) - Molecular Function: transcription factor activity (GO:0003700) - Biological Process: transcription initiation (GO:0006352) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Molecular Function: sigma factor activity (GO:0016987) Sigma factor regions 3 and 4 Sigma-70 region 4 - Molecular Function: DNA binding (GO:0003677) - Molecular Function: transcription factor activity (GO:0003700) - Biological Process: transcription initiation (GO:0006352) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Molecular Function: sigma factor activity (GO:0016987) Sigma-70 region 2 - Molecular Function: DNA binding (GO:0003677) - Molecular Function: transcription factor activity (GO:0003700) - Biological Process: transcription initiation (GO:0006352) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Molecular Function: sigma factor activity (GO:0016987) Sigma-70 factor - Molecular Function: DNA binding (GO:0003677) - Molecular Function: transcription factor activity (GO:0003700) - Biological Process: transcription initiation (GO:0006352) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Molecular Function: sigma factor activity (GO:0016987)	29
2	127490		2
5	138759		2

Preceding Unigenes (1)

Unigene	Build
SGN-U248868	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: