Sol Genomics Network

This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U579112 and SGN-U589853 in the current build, Tomato 200607 #2

Unigene SGN-U212995

Unigene Basic Information

Unigene ID:	SGN-U212995
Unigene Build:	Lycopersicon Combined #3
Date:	2004-06-30
Organism:	S.lycopersicum S.habrochaites S.pennellii
Alternative ID:	212995
mRNA sequence:	Length: 861 bp

>SGN-U212995 Lycopersicon Combined #3 (42 members)
TTGTATCGTATCGTTTTGCCTCTCCGCCGAAACACAACACAGTTGGTGAAGGGTGAAACAAGTTTCAACTGTTGTGTGGCCATGGCTCTG
ATTTTGCATTCAACAGACAACAACAAAAATGCCTCAAAGGCACTCATTGCAGCTGAGTACACAGGTGTTAAGGTTGATCTTGCAAAGGAC
TTCCAGATGGGTGTATCCAACAAGACACCTGAGTTTCTTGAGATGAATCCCATTGGAAAGGTTCCTGTGCTTCAAACACCTGATGGACCT
GTTTTTGAGAGCAATGCCATTGCGCGTTATGTTACCAAAACAAAGCCCAACAATCCTCTTTTTGGCTCTTCATTGATTGAATATGCTCAA
ATTGAACAATGGAATGATTTTTCTGCCACTGAAATTGATGCAAACATTGCACGATGGCTGTACCCACGCCTTGGCTATGCTGTTTACATC
TCTCAAGCTGAGGAAGGTGCAGTAGCTGCATTAAAGAGAGCGCTTGGTGCTTTGAACACCCATCTTGCATCTAACACATACTTGGTTGGA
CATTTTATCACACTGGCTGACATCATCATGGTCTGTAACTTGAGCATTGGTTTTAGGATGATATTGACCAAGAGCTTTACCAAGGAATTT
CCACATGTAGAGAGATATTTCTGGACTGTTGTTAATCAGCCTAATTTCGTCAAGATATTGGGTGAGGTGAAACAAGCTGAATCTATCCCT
GCTGTGCAATCCAAGCCTGCACAACCTGAAAAACTCAAGGCTAAGGAGGAGCCAAAGAAAGAGGTTAAGAAGGAAGAACCAAGTCCTGTA
GAGGAGGAAGCAGCACCCAAGCCTAAGGCAAAGAATCCTCTTGATTTATTG

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (20)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPT	leaf trichomes 4-8 weeks old	2729	1
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	2
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	1
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	1
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	2
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	3
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	2
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	2
Solanum lycopersicum	cLEN	fruit pericarp red ripe to over-ripe	3979	2
Solanum lycopersicum	cLER	leaf 4 weeks	5127	1
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	1
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	2
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	3
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	2
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	2
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	2
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	8
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	2
Solanum lycopersicum	cTSB	seed	1880	1
Solanum habrochaites	cLHT	leaf trichomes 4-8 weeks old	2457	2

mRNA member sequences (42)

Alignment image suppressed for unigene with 42 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (1)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	29	Mal_ac_isom	300
2	22504	EF1_G GST_Cterm Mal_ac_isom GST_Nterm	27
5	57022	EF1_G GST_Cterm Mal_ac_isom GST_Nterm	18

Preceding Unigenes (1)

Unigene	Build
SGN-U143542	Lycopersicon Combined #2

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: