EST details — SGN-E376511

Search information 
Request: 376511Match: SGN-E376511
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C173845Clone name: TUS-17-D3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C173845 is on microarray TOM1 spot ID 1-1-6.4.18.19 [Order] [Tomato Microarray Database]
See unigene SGN-U579408 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C5685 [cLEC-32-K3] Trace: SGN-T29795 EST: SGN-E207582 Direction: 5' Facility: TIGR
Clone: SGN-C173845 [TUS-17-D3] Trace: SGN-T189124 EST: SGN-E376510 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E376511Length: 578 bp (935 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E376511 [] (trimmed) GAAACCACCTACTACCCCTAAACACCCTCCACATGTTAAACCACCTTCCACCCCTAAACACCCTAAACACCCCCCACAAAAACCATGCCCTCCTC
CATCTCATCATGGTCCTAAGCCACCAATTGTAAAACCTCCACATGTACCAAGACCTCCTATAGTGCATCCTCCTCCCATTGTCTCTCCACCTTCC
ACACCTAAACCACCAAAAACACCACCATTCACTCCAAAACCACCATCACCAATACCACCTATTGTTTCACCCCCTATTGTTTATCCACCAATCAC
TCCAACACCACCTATTGTCCATCCACCAGTCACTCCAAAACCACCATCACCAACACCTCCTATTGTTTCACCCCCCATTGTTTATCCACCAATCA
CTCCAACACCACCTGTTGTGTCACCTCCAATCATTCCAACACCACCTATTGTCTCTCCACCTTTTGTCCCCAATCCTCCCGTGGTAATACCACCA
CCCTACGTGCCAAGTCCTCCGGTTGTTACTCCACCCATAGTTCCAACACCCCCTACACCATGCCCACCACCACCACCACCACCAGCAATAATACC
ATCACCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E376511] SGN-U579408 Tomato 200607 Build 2 115 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T189125 [Download][View] Facility Assigned ID: FA0AAD5CB02RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.855 Expected Error Rate: 0.0022 Quality Trim Threshold: 14.5