Capsicum annuum mRNA TC.CA03g09920
mRNA details
|
| Name | Type | Organism |
|
Description
Orf300 protein
|
|
Location(s)
Pepper.v.1.55.chr03:39939479..39939682
|
|
GFF source
PGA1.55
|
mRNA sequence
| spliced mRNA sequence, including UTRs |
>TC.CA03g09920 Orf300 protein
ATGCAGATGGGAATGCATGCTATGAAAGATAGGGTTGAGTCTGATACATCAACCATCTCAATATCCTTGTACAAGTCCACAATGACTACACGAGATAAACCTTGGTTTAGTGTATTGAAGTTGGACTTAGGTGTAATTGAACTCCCAGTTACTGCATACAATCGTATACTAAGGTGTTTCTTGCCATTTGATGGAATGACATGA
ATGCAGATGGGAATGCATGCTATGAAAGATAGGGTTGAGTCTGATACATCAACCATCTCAATATCCTTGTACAAGTCCACAATGACTACACGAGATAAACCTTGGTTTAGTGTATTGAAGTTGGACTTAGGTGTAATTGAACTCCCAGTTACTGCATACAATCGTATACTAAGGTGTTTCTTGCCATTTGATGGAATGACATGA
Genomic sequence(s)
| unprocessed genomic sequence underlying each location of this mRNA |
Related features
|
| Features that derive from this mRNA |
| Type | Name | Location | Length | Strand | Phase |
|---|---|---|---|---|---|
| polypeptide | polypeptide-auto19806107 | Pepper.v.1.55.chr03:39939479..39939682 | n/a | - | n/a |
Add items to a list:
| Features this mRNA is a part of |
| Type | Name | Location | Length | Strand | Phase |
|---|---|---|---|---|---|
| gene | CA03g09920 | Pepper.v.1.55.chr03:39939479..39939682 | 204 | - | n/a |
Add items to a list:
| Features that are parts of this mRNA |
| Type | Name | Location | Length | Strand | Phase |
|---|---|---|---|---|---|
| exon | exon:CA03g09920:1 | Pepper.v.1.55.chr03:39939479..39939682 | 204 | - | n/a |
Add items to a list:
| Related views |
| User comments |
Please wait, checking for comments. (If comments do not show up, access them here)
mRNA details
mRNA details

