Solanum lycopersicum exon exon:Solyc08g075690.2.1.3

Exon details  
Name Type Length
118
Organism
Location(s)
SL2.50ch08:59820935..59821052
GFF source
ITAG_eugene
From BOGAS
1
Related features  
Features this exon is a part of 
TypeNameLocationLengthStrandPhase
mRNASolyc08g075690.2.1SL2.50ch08:59820351..59822984439-n/a
Add items to a list:

Region sequence(s) reference sequence underlying each location of this feature 
>exon:Solyc08g075690.2.1.3 SL2.50ch08:59821052..59820935 (sequence from reverse strand)

GAGGAATTTGAAGCACATGCTGAGAAAGCTAAGACATTGCCTGAGAGTACCACCAATGAGAACAAGCTTATTCTTTACGGACTTTACAAGCAAGCCACCGTTGGCGATGTCAACACAA
Download sequence region Get flanking sequences on SL2.50ch08
Related viewsNone found
http%3A%2F%2Fwww.solgenomics.net%3A8080%2Ffeature%2F17908812%2Fdetails feature 17908812
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)