Solanum lycopersicum mRNA Solyc02g085510.1.1
mRNA details
|
mRNA sequence
| spliced mRNA sequence, including UTRs |
>Solyc02g085510.1.1 Ovate protein (AHRD V1 **-- Q8GSM4_SOLLC); contains Interpro domain(s) IPR006458 Protein of unknown function DUF623, plant
ATGTTTGAGAAGAATGAGCTGGAACAGCTTTTACAATGTTTTCTGTCGTTGAACGGAAAGCATTATCATGGAGTGATAGTTGAGGCGTTCTCAGACATTTGGGAGACTTTGTTTTTAGGTAATAATGATAGAGTAAGGAGGATGTCAATTCATGATCCCACACCCACCTACTGTAGGTAG
ATGTTTGAGAAGAATGAGCTGGAACAGCTTTTACAATGTTTTCTGTCGTTGAACGGAAAGCATTATCATGGAGTGATAGTTGAGGCGTTCTCAGACATTTGGGAGACTTTGTTTTTAGGTAATAATGATAGAGTAAGGAGGATGTCAATTCATGATCCCACACCCACCTACTGTAGGTAG
Genomic sequence(s)
| unprocessed genomic sequence underlying each location of this mRNA |
Related features
|
| Features that derive from this mRNA |
| Type | Name | Location | Length | Strand | Phase |
|---|---|---|---|---|---|
| polypeptide | Solyc02g085510.1.1 | SL2.50ch02:48368929..48369109 | 60 | + | n/a |
Add items to a list:
| Features this mRNA is a part of |
| Type | Name | Location | Length | Strand | Phase |
|---|---|---|---|---|---|
| gene | Solyc02g085510.1 | SL2.50ch02:48368930..48369109 | 180 | + | n/a |
Add items to a list:
| Features that are parts of this mRNA |
| Type | Name | Location | Length | Strand | Phase |
|---|---|---|---|---|---|
| exon | exon:Solyc02g085510.1.1.1 | SL2.50ch02:48368930..48369109 | 180 | + | n/a |
Add items to a list:
| Related views |
| User comments |
Please wait, checking for comments. (If comments do not show up, access them here)
mRNA details
mRNA details

