This unigene is from an out-of-date build,
Nicotiana tabacum #1
It has been superseded by SGN-U441617 in the current build, Nicotiana tabacum #2
It has been superseded by SGN-U441617 in the current build, Nicotiana tabacum #2
Unigene Basic Information |
Unigene ID: | SGN-U382031 |
Unigene Build: | Nicotiana tabacum #1 |
Date: | 2007-05-18 |
Organism: | N.tabacum |
Alternative ID: | 382031 |
mRNA sequence: | Length: 111 bp |
>SGN-U382031 Nicotiana tabacum #1 (1 members)
ATTACGGCCGGGGATGGATAATGTTTTTATTATTAAGCTACATTTAGTCTGTTTTTTTCTTTGCACTGTTTTGTTGATGAAAAATTACTA
GATCTGTTTTTAATTACGCTG
[Blast] [AA Translation]
Associated Loci (0) |
Genomic locations (0) |
![]() |
![]() |
[Show Image]
![]() |
![]() |
![]() |
![]() |
Gene Family (0) |
Preceding Unigenes (0) |