This unigene is from an out-of-date build, Nicotiana tabacum #1
It has been superseded by SGN-U441617 in the current build, Nicotiana tabacum #2
Unigene SGN-U382031

Unigene Basic Information 
Unigene ID: SGN-U382031
Unigene Build: Nicotiana tabacum #1
Date: 2007-05-18
Organism: N.tabacum
Alternative ID: 382031
mRNA sequence: Length: 111 bp

>SGN-U382031 Nicotiana tabacum #1 (1 members)
ATTACGGCCGGGGATGGATAATGTTTTTATTATTAAGCTACATTTAGTCTGTTTTTTTCTTTGCACTGTTTTGTTGATGAAAAATTACTA
GATCTGTTTTTAATTACGCTG


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E795435
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (1)  
Gene Family (0)None
Preceding Unigenes (0)None