This unigene is from an out-of-date build,
Coffea canephora #2
It has been superseded by SGN-U617469 in the current build, Coffea canephora #3
It has been superseded by SGN-U617469 in the current build, Coffea canephora #3
Unigene Basic Information |
Unigene ID: | SGN-U357069 |
Unigene Build: | Coffea canephora #2 |
Date: | 2007-05-18 |
Organism: | C.canephora |
Alternative ID: | 357069 |
mRNA sequence: | Length: 82 bp |
>SGN-U357069 Coffea canephora #2 (1 members)
CTCCCGGATCACAATGAGAGCATGACTGTTGTCCTTGACCGATTTGGATCTATTGGTATTGATGCCCCTGGAGTTGTTGCCT
[Blast] [AA Translation]
Associated Loci (0) |
Genomic locations (0) |
![]() |
![]() |
[Show Image]
![]() |
![]() |
![]() |
![]() |
Gene Family (0) |
![]() |