Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.


This unigene is from an out-of-date build, Coffea canephora #2
It has been superseded by SGN-U617469 in the current build, Coffea canephora #3
Unigene SGN-U357069

Unigene Basic Information 
Unigene ID: SGN-U357069
Unigene Build: Coffea canephora #2
Date: 2007-05-18
Organism: C.canephora
Alternative ID: 357069
mRNA sequence: Length: 82 bp

>SGN-U357069 Coffea canephora #2 (1 members)
CTCCCGGATCACAATGAGAGCATGACTGTTGTCCTTGACCGATTTGGATCTATTGGTATTGATGCCCCTGGAGTTGTTGCCT

[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E643832
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)