This unigene is from an out-of-date build,
Tomato 200607 #1
The current build is, Tomato 200607 #2
The current build is, Tomato 200607 #2
Unigene Basic Information |
Unigene ID: | SGN-U346474 |
Unigene Build: | Tomato 200607 #1 |
Date: | 2006-07-27 |
Organism: | S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides |
Alternative ID: | 346474 |
mRNA sequence: | Length: 63 bp |
>SGN-U346474 Tomato 200607 #1 (1 members)
ATGGAGAACTTCCCAATTATTAACTTGGAAAAGCTCAATGGAGATGAGAGAGCCAACACCATG
[Blast] [AA Translation]
![]() |
Locus symbol | Locus name | Gene activity |
---|---|---|
efe | ethylene-forming enzyme | ethylene-forming enzyme |
Genomic locations (0) |
![]() |
![]() |
[Show Image]
![]() |
![]() |
![]() |
![]() |
![]() |
Preceding Unigenes (0) |