Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U588937 in the current build, Tomato 200607 #2

Unigene SGN-U344228

Unigene Basic Information

Unigene ID:	SGN-U344228
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	344228
mRNA sequence:	Length: 328 bp

>SGN-U344228 Tomato 200607 #1 (1 members)
CGTACTAGTGAGAGATGAGGGTCATATAATGCTGTCTGATTTTGACTTATCTCTCCGTTGTTCTGTCAATCCAACGCTTGTTAAGTCTTC
ATCTGTACACGGAGGAGGAGGAGGAGGAAATCCTAGCAGTGGATCGGGCATTTTAGACAATGACAATGCAGTCCAAGGTTGTATTCAGCC
CTCGACTTTTTTCCCTCGTAACATTCTTCCTACCAAAAAGAATCGCAAGTCTAAATCAGATTTTGGTCTTTTTGTGGGAGGATCACTCCC
TGAGCTTATGGCAGAGCCGACTAATGTGCGTTCCATGTCTTTTGTTGGTACACACGAG

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
pk4	protein kinase 4	protein kinase

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	vSlycmRNA		8362	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E744911
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 3 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101361	Protein kinase - Molecular Function: protein kinase activity (GO:0004672) - Molecular Function: ATP binding (GO:0005524) - Biological Process: protein amino acid phosphorylation (GO:0006468) Protein kinase-like	1515
2	118461	Protein kinase-like Protein kinase - Molecular Function: protein kinase activity (GO:0004672) - Molecular Function: ATP binding (GO:0005524) - Biological Process: protein amino acid phosphorylation (GO:0006468) Serine/threonine protein kinase - Molecular Function: protein serine/threonine kinase activity (GO:0004674) - Molecular Function: ATP binding (GO:0005524) - Biological Process: protein amino acid phosphorylation (GO:0006468)	115
5	128997	Protein kinase-like Protein kinase - Molecular Function: protein kinase activity (GO:0004672) - Molecular Function: ATP binding (GO:0005524) - Biological Process: protein amino acid phosphorylation (GO:0006468) Serine/threonine protein kinase - Molecular Function: protein serine/threonine kinase activity (GO:0004674) - Molecular Function: ATP binding (GO:0005524) - Biological Process: protein amino acid phosphorylation (GO:0006468) Serine/threonine protein kinase active site - Molecular Function: protein serine/threonine kinase activity (GO:0004674) - Biological Process: protein amino acid phosphorylation (GO:0006468)	72

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: