Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U591544 in the current build, Tomato 200607 #2

Unigene SGN-U334552

Unigene Basic Information

Unigene ID:	SGN-U334552
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	334552
mRNA sequence:	Length: 734 bp

>SGN-U334552 Tomato 200607 #1 (1 members)
GCAGATCTTAGAAACCCTAATTATTATATTCTGTAAAGATGGCGACTGAAGAGCCGGTTGTAGCAATCGAGCCTGTGAATGAACCGATGG
TCGTAGCTGAACCTGCGACGGAAGAAAATCCACCGGCGGAGACTGATGAACCAAAGAAAGAGAAGGAGATCAAGGCGAAAAAATCATCTG
CTCCGAGGAAGAGAAATCCTCCGACTCATCCTTCCTACTTTGAGATGATTAAGGAAGCGATTGTAACATTGAAGGATAAAACTGGATCGA
GTCAGTATGCGATCACAAAGTTCATTGAAGATAAGCAGAAAAATCTTCCATCAAATTTCAGGAAAATGTTGCTTGCTCAATTGAAGAAGC
TTGTGGCTTCTGGTAAACTTGTCAAGGTGAAGAGCTCCTACAAGCTTCCAGCTCCAAAGGCAGCTGCTCCTGCTCTTGCTAAGAAAAAGT
CCATAGCTAAGCCAAAAGCAGCACAGGCAAAGAAGGCCACCAAGGCAAAGCCGAAGCCAAAACCAAAGGTTGCTGCTCCAAAGGCCAAAG
CCTAAGGGCAGTTGTAGCAAAGCCGAAAGCAGCTGTAAAGCCTAAAGCCCCTGTAAAAGCTAAGGCTGCTGTAAAGCCAAAAGCGGCTAA
TGAGAAGCCAGCTAAGGTAGCAAGGACATCTACTAGGTCGACTCCGTCGAGGAAAGCTGCACCGAAGCCAGCTGTGAAAAAGCACCCGGT
GAAGAGTGTGAAAT

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
h1	histone H1

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E345158
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 5 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101473	Myb DNA-binding - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634)	112
2	118777	Histone H5 - Cellular Component: nucleosome (GO:0000786) - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634) - Biological Process: nucleosome assembly (GO:0006334) Winged helix repressor DNA-binding Histone H1/H5 - Cellular Component: nucleosome (GO:0000786) - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634) - Biological Process: nucleosome assembly (GO:0006334) Linker histone N-terminal - Cellular Component: nucleosome (GO:0000786) - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634) - Biological Process: nucleosome assembly (GO:0006334) - Biological Process: chromosome organization and biogenesis (sensu Eukaryota) (GO:0007001)	30
5	129393	Histone H5 - Cellular Component: nucleosome (GO:0000786) - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634) - Biological Process: nucleosome assembly (GO:0006334) Winged helix repressor DNA-binding Histone H1/H5 - Cellular Component: nucleosome (GO:0000786) - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634) - Biological Process: nucleosome assembly (GO:0006334) Linker histone N-terminal - Cellular Component: nucleosome (GO:0000786) - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634) - Biological Process: nucleosome assembly (GO:0006334) - Biological Process: chromosome organization and biogenesis (sensu Eukaryota) (GO:0007001)	22

Preceding Unigenes (1)

Unigene	Build
SGN-U232742	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: