Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U571799 in the current build, Tomato 200607 #2

Unigene SGN-U316302

Unigene Basic Information

Unigene ID:	SGN-U316302
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	316302
mRNA sequence:	Length: 1244 bp

>SGN-U316302 Tomato 200607 #1 (29 members)
TCTGCTATTTTTTCTCCGATCGAAGATCAACTATTCCGATTTCCGACGATGAATGTGATGGATTCAGCTCCGGCTAAAAGTAGCTTAATG
AGTCCCGAATCTGATATTCAGAGAACACAGTTTCCATATGTGACTGGGACATCAGTTGTCGGCATCAAGTACAAAGATGGTATTCTCTTG
GCAGCTGACATGGGAGGTTCCTATGGTTCAACGATACGTTACAAGAGTGTGGATCGATTAAAGCCAGTGGGAAAACACTCCCTTCTTGGT
GCAAGTGGTGAAATAAGTGATTTTCAGGAGATAATGAAGTACCTTGATGAGCTTATCTTGTATGACAACATGTGGGATGATGGGAACTCC
TTGGGTCCCAAAGAAGTGCATAACTACCTAACACGTGTGATGTATAATCGTCGCAACAAGTTCAACCCACTTTGGAATTCACTTGTTCTT
GGTGGAGTAAAAAATGGACAGAAGTATCTTGGAACAGTTAGTATGATTGGTGTGCATTACGAGGACAACCATGTGGCTACTGGATTTGGG
AATCATCTTGCGAGGCCCATTCTTCGTGACGAATGGCATGAAAATTTGAGTTATGAAGAGGGCGTTAAGTTATTGGAGAAATGTATGCGT
GTGCTTTTGTATCGAGACAGATCTGCAGTCAACAAGCTTCAGATTGCAAAAATCACAGAAGAGGGAGTAACAATTTCTCAGCCATACTCA
TTGAAGACTTTCTGGAACTTCTCTGCTTTCCAGAATCCAACCGTTGGTGCTGAGGGTTCATGGTAATAACTGATTGCTGCGTCGACTAGG
TTTGATGAAGGAACTACACAATGTGTTGCAGATTATAGAACTGTTTTCATGGAAGTGATGTTTGATAGAACTCGTGTAATTTGAATTGTC
TATGGTCTTTCTAGGTTTTTTCCTAATGTAAACTATAAAAGACATGTCTCCTGATGTTTCACTTTTCCTTCACTATGTGAGATTGTTATC
TTCCAAAGTTACTTGGCATGCCATGGCTCATCTCAGTTATGGAACGTGGTCGTTTTTCGCCTGGTTGATATATTTTCTAAGTTCATACAG
AAGTACACGCCCCTGGTTTACCTACTTTTAAGTTGCGTTGCTTGGACTCTTGACAATTTTGTCACATTCAAGTGTTTGATCCTCTAAAAA
TGCTCTATTTTTGGAGGATCAACATAGTCGGAGACATCTTTTTGAAGAGTTTGAGCTATGTTATCGACACTTAT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (13)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	6
Solanum lycopersicum	LB	Leaf Mature leaves	3316	1
Solanum lycopersicum	LE08	Fruit 8 days post anthesis	339	1
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	1
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	2
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	2
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	1
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	2
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	2
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	1
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	1
Solanum lycopersicum	cTOS	suspension cultures	8026	8
Solanum lycopersicum	t3_tus	Rearrayed collection of L. esculentum cDNA clones	1883	1

mRNA member sequences (29)

Alignment image suppressed for unigene with 29 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101456	20S proteasome A and B subunits - Molecular Function: threonine endopeptidase activity (GO:0004298) - Cellular Component: proteasome core complex (sensu Eukaryota) (GO:0005839) - Biological Process: ubiquitin-dependent protein catabolism (GO:0006511)	138
2	122168	20S proteasome A and B subunits - Molecular Function: threonine endopeptidase activity (GO:0004298) - Cellular Component: proteasome core complex (sensu Eukaryota) (GO:0005839) - Biological Process: ubiquitin-dependent protein catabolism (GO:0006511) Peptidase T1A proteasome beta-subunit - Molecular Function: endopeptidase activity (GO:0004175) - Cellular Component: proteasome core complex (sensu Eukaryota) (GO:0005839) - Biological Process: ubiquitin-dependent protein catabolism (GO:0006511)	5
5	132387	20S proteasome A and B subunits - Molecular Function: threonine endopeptidase activity (GO:0004298) - Cellular Component: proteasome core complex (sensu Eukaryota) (GO:0005839) - Biological Process: ubiquitin-dependent protein catabolism (GO:0006511) Peptidase T1A proteasome beta-subunit - Molecular Function: endopeptidase activity (GO:0004175) - Cellular Component: proteasome core complex (sensu Eukaryota) (GO:0005839) - Biological Process: ubiquitin-dependent protein catabolism (GO:0006511)	5

Preceding Unigenes (1)

Unigene	Build
SGN-U215895	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: