Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U568670 and SGN-U589630 in the current build, Tomato 200607 #2

Unigene SGN-U316193

Unigene Basic Information

Unigene ID:	SGN-U316193
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	316193
mRNA sequence:	Length: 1510 bp

>SGN-U316193 Tomato 200607 #1 (30 members)
CTCACATCTCAGTTTGTTTTGAGAAGTACAGGGAAGGGTTAGCAGTTAGCACTCTGAAACATTTTTTTATGAGATAAGGAATTTCATTAA
ATGTTATCATTGCGCTTCTCTTTAGATCTCACATCTCAGGTATTCTGCAGTAAAGAAAAAAATGTCACGAAGGTATGATAGCCGAACAAC
AATCTTCTCCCCAGAAGGTCGTCTCTACCAAGTTGAGTACGCAATGGAGGCTATTGGAAATGCAGGTAGTGCTATAGGCATCTTGTCCAA
GGATGGGGTGGTGTTGGTAGGTGAAAAGAAAGTTACATCTAAGCTGCTTCAGACCTCTACTTCAAGTGAGAAGATGTACAAGATCGATGA
TCATGTGGCATGCGCTGTAGCTGGAATTATGTCTGATGCCAACATTCTGATCAACACAGCCAGGTTTCAGGCTCAGCGCTATACGTTCGC
TTATCAAGAACCCATGCCAGTTGAGCAACTTGTCCAGTCACTATGTGATACCAAGCAAGGTTACACACAGTTTGGTGGGCTTCGCCCTTT
TGGTGTTTCATTTCTCTTTGCAGGTTGGGATAAAAACTATGGCTTCCAACTTTACATGAGCGACCCAAGTGGAAATTACGGTGGTTGGAA
AGCCGCAGCAATTGGAGCAAACAACCAGGCAGCTCAATCAATTCTTAAGCAGGATTACAAGGATGATATCACAAGGGAAGAGGCCGTTCA
ACTTGCTCTTAAAGTGCTTGGTAAGACAATGGACAGCACTAGCCTCACTTCGGAGAAACTTGAACTTGCTGAGGTATTTCTCTCTAACGG
GAAAGTCAAGTATCAAGCATGCTCTCCCGAAACTCTGAACAAAATGTTGGTGAGTGCTGGACTGACTCAACCTACAGCAGAAGAATAGTC
GTAGAATGCCTTCCAATCTAGCATATGACATCATTGAACTCTCTCTACGCCATGTGTGACATGTTGTACTAAAACTAAGTGGTGGATTTG
TCTTCTTACAACTGCATGCATATTTATGTCAAATGCTTTCCAGTTTGAATTTTGTTTTGGATTTAAAAAAAAAAAAAAAAATATCGTGGT
ACTTTACTGCATTTGACATGTTTGTGCCTCTGTTTGCCTGAGAAAGAAAAGAACACACAAACATACCCTCCATCTTTCTCAATTTTAACT
TGATGCAACTACCGTAGGGGAAGAAGGTGAGATCTTTTCATCTTGTAGCTATCCATTTTAAACATTATTTCCTTCCTCCGACTAGTAACT
ATTTAGTCCTCTAAAGCTCTGAGGATTTTGGTTATGTAGTGGTGATTATACCAAAGCAGAAGGTATGATGATTATTCAGAATGGAAGGAA
TAATGTGCAAGTAGAAGGTATGTTTATCATTTTGATCGCATGAATGTCTACCTAAAGCTTATCATCATGACCTCTCACAAAAATGTAAAA
ACAGTTACTTTGGACATAATATCAGATAGTTTCATATCATAATATAATGGTAACTATTACCATTTTACAT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (15)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	4
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	1
Solanum lycopersicum	LA	Leaf Mature leaves	6589	2
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	3
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	4
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	2
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	1
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	2
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	1
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	2
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	1
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	1
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	2
Solanum lycopersicum	cTOS	suspension cultures	8026	3
Solanum habrochaites	cLHT	leaf trichomes 4-8 weeks old	2457	1

mRNA member sequences (30)

Alignment image suppressed for unigene with 30 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (2)

Annotations (manual: 1 | blast: 2 | go: 3 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101456	20S proteasome A and B subunits - Molecular Function: threonine endopeptidase activity (GO:0004298) - Cellular Component: proteasome core complex (sensu Eukaryota) (GO:0005839) - Biological Process: ubiquitin-dependent protein catabolism (GO:0006511)	138
2	118543	20S proteasome A and B subunits - Molecular Function: threonine endopeptidase activity (GO:0004298) - Cellular Component: proteasome core complex (sensu Eukaryota) (GO:0005839) - Biological Process: ubiquitin-dependent protein catabolism (GO:0006511) Proteasome alpha-subunit - Molecular Function: endopeptidase activity (GO:0004175) - Cellular Component: proteasome core complex (sensu Eukaryota) (GO:0005839) - Biological Process: ubiquitin-dependent protein catabolism (GO:0006511)	58
5	131014	20S proteasome A and B subunits - Molecular Function: threonine endopeptidase activity (GO:0004298) - Cellular Component: proteasome core complex (sensu Eukaryota) (GO:0005839) - Biological Process: ubiquitin-dependent protein catabolism (GO:0006511) Proteasome alpha-subunit - Molecular Function: endopeptidase activity (GO:0004175) - Cellular Component: proteasome core complex (sensu Eukaryota) (GO:0005839) - Biological Process: ubiquitin-dependent protein catabolism (GO:0006511)	8

Preceding Unigenes (1)

Unigene	Build
SGN-U215458	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: