Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U563726 in the current build, Tomato 200607 #2

Unigene SGN-U313919

Unigene Basic Information

Unigene ID:	SGN-U313919
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	313919
mRNA sequence:	Length: 1425 bp

>SGN-U313919 Tomato 200607 #1 (46 members)
AATAACACAACACCGAAGATATTATTTATGTATTTCAGTAAAAACGATGCTGAAAAAAGCGAAAAGCGATTGATCCAGGACGCGAGCCAA
CCACGTTACTTAGAAATAATCTAACGATTACAAATCCGACACGTCATCAATATTCGACACAGATCCCAACTCATTCACGGCAAAGCTTAT
TAGTCGACGAAACAATAAATACAACCTCAAATATTTTTCACATGTACCGAACTACCCCTTCCACATCCACCCATTCTCAAACACAAAACC
ACCCAATGTCGGTTTCTTTTACATGCCTATTTCCGTCATTTAATACCAATATTTTTCTTTAATATAAAATCCCCCTCTATTGGCTTTCTC
TAGTAGCAACCTATCCAATCACTCCGTTTTTGGTATTCATTCATTCTTCAATGGCGACTAGTTTAATCCGACGAGCGATTTCTAGGGTTC
AGTCATCAGCACCGGCGGCGAGGCTACTCGTCGCCAGAGCTCACGCTTCCGACTCCCAAGCACAGAAGGTAGAATCTAAGCCTAATCTCA
AATCATTTCAAATTTACCGATGGACTCCAGACAACCCAGGGAAACCTGAGCTCAAAGAATACAAAATCGATCTGAAGGAATGCGGACCTA
TGGTTTTAGATGCGCTAATCAAAATCAAGAATGAAATTGACCCTACACTTACCTTCAGGAGATCCTGTAGAGAAGGGATCTGTGGTTCAT
GTGCTATGAACATCGACGGATGTAATGGACTCGCTTGTTTGACCAAGATCTCGTCGGATTCTGAATCGACGATTACGCCGTTGCCACATA
TGTTTGTCATTAAGGATCTGGTGGTGGATATGACTAATTTCTATAATCAGTACAAGTCTATTGAGCCTTGGCTTAAGAGGAAGACACCTG
CACCAACGCCTGGGAAGGAGATACCACAGAGCAAGAGCGATAGGGCTAAGTTGGATGGGATGTACGAATGTATTCTATGTGCTTGCTGTA
GCACATCATGTCCTAGCTACTGGTGGAATCCTGAGTCTTATCTTGGTCCCGCTGCACTCCTCCATGCCAACCGATGGATCATGGATAGCC
GTGATGAATATACTCAGGAGCGCCTGGATGCAGTTAATGACGAATTCAAGCTTTATCGCTGCCATACTATTCTGAATTGTTCTCGTGCTT
GCCCAAAGGGATTAAATCCCGGGAAGCATATTCAGAACATCAAGAAGCTGGAGATGGCACCTTGAGCCTGCAGTGTAGTGTGTTCCAATC
TTTTCTGCTAAGATTGATTTTGAAGGACTAGTAGGAGGTTGTGTCCCAAAATAATGTATGCACAGATTGTAATTTACTCTCTGAGATCTT
TTTAATACTGGAATTTGAGATGAAAGGGGCATCTCTCTGAAATATAATACCGTATCAATTTCAAGTAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
sucdh	succinate dehydrogenase	succinate dehydrogenase

Genomic locations (0)

None

Library representation (16)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPP	pollen pollen collected from open flowers	5426	4
Solanum pennellii	cLPT	leaf trichomes 4-8 weeks old	2729	1
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	14
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	3
Solanum lycopersicum	LA	Leaf Mature leaves	6589	3
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	1
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	4
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	2
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	4
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	2
Solanum lycopersicum	cLEN	fruit pericarp red ripe to over-ripe	3979	2
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	2
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	1
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	1
Solanum lycopersicum	cTSC	seed	2256	1
Solanum lycopersicum	vSlycmRNA		8362	1

mRNA member sequences (46)

Alignment image suppressed for unigene with 46 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (1)

Annotations (manual: 2 | blast: 2 | go: 6 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	102538	Ferredoxin - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) 2Fe-2S Ferredoxin-like fold - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) 4Fe-4S ferredoxin iron-sulfur binding - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) Fumarate reductase C-terminal - Molecular Function: iron ion binding (GO:0005506) - Cellular Component: membrane (GO:0016020) - Molecular Function: oxidoreductase activity (GO:0016491) 2Fe-2S ferredoxin iron-sulfur binding site - Molecular Function: electron transporter activity (GO:0005489) - Biological Process: electron transport (GO:0006118) Alpha-helical ferredoxin Succinate dehydrogenase/fumarate reductase iron-sulfur protein - Biological Process: tricarboxylic acid cycle (GO:0006099) - Biological Process: electron transport (GO:0006118) - Molecular Function: oxidoreductase activity (GO:0016491)	13
2	119728	2Fe-2S Ferredoxin-like fold - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) 2Fe-2S ferredoxin iron-sulfur binding site - Molecular Function: electron transporter activity (GO:0005489) - Biological Process: electron transport (GO:0006118) 4Fe-4S ferredoxin iron-sulfur binding - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) Ferredoxin - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) Succinate dehydrogenase/fumarate reductase iron-sulfur protein - Biological Process: tricarboxylic acid cycle (GO:0006099) - Biological Process: electron transport (GO:0006118) - Molecular Function: oxidoreductase activity (GO:0016491) Fumarate reductase C-terminal - Molecular Function: iron ion binding (GO:0005506) - Cellular Component: membrane (GO:0016020) - Molecular Function: oxidoreductase activity (GO:0016491) Alpha-helical ferredoxin	13
5	130055	2Fe-2S Ferredoxin-like fold - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) 2Fe-2S ferredoxin iron-sulfur binding site - Molecular Function: electron transporter activity (GO:0005489) - Biological Process: electron transport (GO:0006118) 4Fe-4S ferredoxin iron-sulfur binding - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) Ferredoxin - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) Succinate dehydrogenase/fumarate reductase iron-sulfur protein - Biological Process: tricarboxylic acid cycle (GO:0006099) - Biological Process: electron transport (GO:0006118) - Molecular Function: oxidoreductase activity (GO:0016491) Fumarate reductase C-terminal - Molecular Function: iron ion binding (GO:0005506) - Cellular Component: membrane (GO:0016020) - Molecular Function: oxidoreductase activity (GO:0016491) Alpha-helical ferredoxin	13

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U214273	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: