Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U581024 in the current build, Tomato 200607 #2

Unigene SGN-U313095

Unigene Basic Information

Unigene ID:	SGN-U313095
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	313095
mRNA sequence:	Length: 1010 bp

>SGN-U313095 Tomato 200607 #1 (109 members)
ATCGGCCGAATTGAACTTGTGCCCCCCTTAATAGTGAAAATTTTCAATTGTTAATTTTCTCGTTAAAAATGCCGATCAACCAAATTACTA
TTGGAAGCCATGAGGAACTCCGCCATCCCGGGGCGCTTAAAGCGGCCTTGGCGGAGTTCATCAGTACCCTGATCTTCGTATTCGCAGGTC
AGGGTTCTGGTATGGCTTTCAATAAGCTTACCGATGGCGTCGCTACTCCCGCTGGCCTTATTTCCGCCTCCATAGCACACGCCTTCGGGT
TGTTCGTCGCCGTCTCCGTCGGTGCTAACATCTCCGGCGGCCACGTCAACCCTGCTGTTACCTTCGGTGCTTTTGTTGGTGGAAACATCA
CTTTGTTCCGTGGAATTTTGTACATCATTGCACAGTTGCTTGGATCCACTGCTGCTTGCGCTCTCCTTGAATTCGCCACCGGTGGCATGA
GCACGGGATCATTTGCATTGTCAGCCGGTGTATCAGTATGGAACGCGTTCGTATTCGAGATTGTGATGACTTTCGGTCTCGTTTACACTG
TTTACGCAACCGCAGTTGACCCAAAGAAGGGAGATTTGGGTGTGATTGCACCAATTGCAATTGGTTTCATTGTTGGTGCCAACATTCTTG
CTGGTGGTGCCTTTACTGGAGCTTCAATGAACCCAGCTGTGTCATTTGGCCCATCTTTGGTTAGCTGGACCTGGACTCACCAATGGGTTT
ACTGGGCTGGACCACTTATTGGTGGTGGGCTTGCTGGATTCATCTATGAATTCATCTTCATTAGCCACACTCATGAGCAAATCCCAAGTG
GAGATTTTTAAGTAGTGCTGAATTTTTATCAACTCGTTGTTTAATTTTCATTTTCTCTTTGTAAACTTCTTTGTTTGTTTGTCTATGTTT
AATGGGCACTGTTGAATTGTACTTTGTTTATTCAAAAGGCTTTTGTTATTTATTTTCTTTATTTTGATCGTGGTAAATAAGATATTTTGA
TTTGTTTTAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
SlTIP1.1	tonoplast intrinsic protein 1.1	water channel protein

Genomic locations (0)

None

Library representation (22)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	8
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	1
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	1
Solanum lycopersicum	LA	Leaf Mature leaves	6589	4
Solanum lycopersicum	LC	Leaf Mature leaves	5712	3
Solanum lycopersicum	LE12	Fruit 12 days post anthesis	276	1
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	2
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	3
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	2
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	11
Solanum lycopersicum	cLER	leaf 4 weeks	5127	11
Solanum lycopersicum	cLES	leaf 4 weeks	5243	6
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	14
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	4
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	5
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	6
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	7
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	6
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	2
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	10
Solanum lycopersicum	cTSB	seed	1880	1
Solanum lycopersicum	vSlycmRNA		8362	1

mRNA member sequences (109)

Alignment image suppressed for unigene with 109 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (2)

Annotations (manual: 2 | blast: 2 | go: 3 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101425	Major intrinsic protein - Molecular Function: transporter activity (GO:0005215) - Biological Process: transport (GO:0006810) - Cellular Component: membrane (GO:0016020)	199
2	118438	Major intrinsic protein - Molecular Function: transporter activity (GO:0005215) - Biological Process: transport (GO:0006810) - Cellular Component: membrane (GO:0016020)	168
5	129060	Major intrinsic protein - Molecular Function: transporter activity (GO:0005215) - Biological Process: transport (GO:0006810) - Cellular Component: membrane (GO:0016020)	50

Preceding Unigenes (1)

Unigene	Build
SGN-U213272	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: