Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U578242 in the current build, Tomato 200607 #2

Unigene SGN-U312841

Unigene Basic Information

Unigene ID:	SGN-U312841
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	312841
mRNA sequence:	Length: 986 bp

>SGN-U312841 Tomato 200607 #1 (59 members)
TTAAGGGATCTACCTGTCACATCTTCAAAGTACTAGGGGGTTCTAAGTGAAAATTACCTCTCACTGATACGTTACAGATCAAAAGCACTT
TCTCATTTTTCTTTCACTGCTATATATATAAAGGCGATTGGCGGCGTAATCGGCCGAATTGACCAGTTCCAGAATTCTGAATTGCAGTAT
CATAGGGCTTAGGAGGATCTCTGAGGGATTTGGTCTGCTATGGCATCCAAGCGGATTCTCAAGGAGCTTAAGGATCTCCAGAAAGATCCT
CCTACCTCTTGCAGTGCTGGCCCAGTAGCTGAAGATATGTTCCATTGGCAAGCAACAATCATGGGTCCAGCTGACAGTCCCTATTCTGGT
GGAGTGTTTCTTGTTACTATTCATTTTCCACCTGACTATCCATTCAAGCCACCAAAGGTAGCTTTCAGGACAAAGGTTTTCCACCCGAAC
ATCAATAGCAATGGCAGCATTTGCCTTGACATTTTGAAGGAACAGTGGAGCCCTGCACTTACCATCTCCAAGGTACTGCTCTCTATCTGT
TCTCTGCTGACAGACCCTAATCCCGATGACCCTTTGGTGCCGGAGATTGCTCATATGTACAAAACTGATAGGAGCAAGTATGAGACAACT
GCCCGGAGCTGGACTCAAAAATTTGCCATGGGATAGTTGCTGTGACCATCTCTGTCCCTGCTGTGGTAATTTGTATTATCTATCGAATAG
TTGCTGTGACCATCGGGGTCTGATTCCCTGCTGTGGTATTTAGTAGTTTATATATTATGTATTATGAAATTGTGTTCTTATGCATAATCA
AAACTTAAAAGGCGGGAAAGTCGAACAGGTTCATCGTGAAACAATTTGATTTTCTCTTTGCTTGCAAGAATGTTATCAGTTATGGTGTTA
AAACTCTTATGTTGGGTTCAAAGTATGCATTTTAACCCTTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
ubc2	ubiquitin conjugating enzyme E2

Genomic locations (0)

None

Library representation (19)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	2
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	6
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	21
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	1
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	4
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	6
Solanum lycopersicum	cLES	leaf 4 weeks	5243	1
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	1
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	1
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	1
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	1
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	1
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	1
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	2
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	2
Solanum lycopersicum	cTOS	suspension cultures	8026	4
Solanum lycopersicum	cTSB	seed	1880	1
Solanum lycopersicum	cTSC	seed	2256	2
Solanum lycopersicum	vSlycmRNA		8362	1

mRNA member sequences (59)

Alignment image suppressed for unigene with 59 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 1 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101402	Ubiquitin-conjugating enzyme E2 - Molecular Function: ubiquitin-protein ligase activity (GO:0004842) - Biological Process: protein modification (GO:0006464) - Biological Process: ubiquitin cycle (GO:0006512)	283
2	118431	Ubiquitin-conjugating enzyme E2 - Molecular Function: ubiquitin-protein ligase activity (GO:0004842) - Biological Process: protein modification (GO:0006464) - Biological Process: ubiquitin cycle (GO:0006512)	197
5	128961	Ubiquitin-conjugating enzyme E2 - Molecular Function: ubiquitin-protein ligase activity (GO:0004842) - Biological Process: protein modification (GO:0006464) - Biological Process: ubiquitin cycle (GO:0006512)	109

Preceding Unigenes (1)

Unigene	Build
SGN-U213336	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: