Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U579007 in the current build, Tomato 200607 #2

Unigene SGN-U312658

Unigene Basic Information

Unigene ID:	SGN-U312658
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	312658
mRNA sequence:	Length: 1364 bp

>SGN-U312658 Tomato 200607 #1 (36 members)
GAGTAGGGTTTTTGTTTAGGTATTTGAGGCAGCAGTAATTGTTGTCTTCACAAACAGCGTCTCCTCATTCCCCTACCGCCGTCGGAGGCT
AATTCACAAGCAACCAACAATGGCATTCATCAAAGTCCAGAAGACTAGGGCTTACTTTAAGCGTTTCCAGGTTAAATTCAAGAGAAGGAG
AGAGGGAAAGACTGACTACAGAGCCAGGAATCGCTTGATAAATCAGGACAAAAACAAGTACAACACTCCAAAATATCGTTTTGTTGTCCG
ATTTACTAATAAGGACATAATTGCCCAAATTGTGTCTGCTAGCATAGCTGGTGACATGATTCTTGCCTCTGCATATGCTCGTGAGCTGCC
TCAGTTTGGCCTTCAAGTTGGACTCACAAATTATGCTGCTGCATACTGTACCGGACTTCTCTTGGCAAGACGAGTTCTCAAAAAACTTGA
AATGGATGAGGAGTATCAAGGGAACCCTGAGGCAAGTGGAGAGGATTACTCAGTTGAACTTGCTGAAAGCAGGAGGCCTTTCCGTGCTCT
CTTGGATGTTGGTCTTATTAGAACTACTACTGGAAATCGTGTGTTTGGTGCTCTCAAGGGTGCATTGGATGGTGGACTTGATATTCCTCA
TGGTGAGAAGAGGTTTGCTGGATTCAGCAAAGATTCCAAGCAACTTGATGCTGAGGTTCACCGCAAGTATATATATGGTGGCCATGTTGC
AACATATATGAAGACTTTGATCGAAGATGAACCTGAGAAATATCAGTCTCACTTTAGTGGGTACATTAAGCGGGGTCTTGAGGCTGATAA
TCTTGAAGAGATGTACAAGAAGGTTCATGCTGCCATACGTGCCGAACCAAGCCCAAAGAAATCTGAGAAGCAGCCTCCCAAGAAGCACAA
GAGGTACAATCTGAAGAAGCTGACTTATGAGGAAAGAAAGGCTAAGTTGATTGAAAGACTGAATGCTTTGAATTCAGCTGCTGGAAATGA
TGAGGATGAGGATGATGATGAGTGAAGACACTAGAATTATAAAATTTTGGTGCTTAATAGTTTTGTGATATTGTCGTTTCTTCCTAGGGA
GAAATCTCAGTTCTGTATGCTTTAGTACAATTTTTCTTGCTGTATGACAATGTAGGAGGTTAGATTTGCAAGTGTGCACAAATCCCATCA
AGCACACGCATGAATAGCAATCAGTAATTTTGGAACCTTGACTCATCTCTCTGGATCTACAAATGCAGTGTGAAATGTTTCTTTTTATTC
TTTTGGTTTTTATGAAGAAATGATTGGTTTCTTTATGGATGAAAATCAAGGATTTATGAAGTGACACATCATTAATGTTGGGGAAAAAAA
AAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (23)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPP	pollen pollen collected from open flowers	5426	1
Solanum pennellii	cLPT	leaf trichomes 4-8 weeks old	2729	1
Solanum lycopersicum	LE15	Fruit 15 days post anthesis	269	1
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	1
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	2
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	1
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	1
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	1
Solanum lycopersicum	cLEN	fruit pericarp red ripe to over-ripe	3979	1
Solanum lycopersicum	cLES	leaf 4 weeks	5243	1
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	1
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	2
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	1
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	3
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	1
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	3
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	1
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	2
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	4
Solanum lycopersicum	cTOS	suspension cultures	8026	3
Solanum lycopersicum	cTSB	seed	1880	1
Solanum lycopersicum	vSlycmRNA		8362	1
Solanum habrochaites	LH_Ea	Glandular Trichomes	3840	2

mRNA member sequences (36)

Alignment image suppressed for unigene with 36 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 1 | blast: 2 | go: 6 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101758	Zinc finger FYVE-type - Molecular Function: zinc ion binding (GO:0008270) Zinc finger FYVE/PHD-type - Molecular Function: zinc ion binding (GO:0008270)	40
2	119267	Ribosomal protein L18P/L5E - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Eukaryotic ribosomal protein L5 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) - Molecular Function: 5S rRNA binding (GO:0008097)	18
5	129613	Ribosomal protein L18P/L5E - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Eukaryotic ribosomal protein L5 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) - Molecular Function: 5S rRNA binding (GO:0008097)	18

Preceding Unigenes (1)

Unigene	Build
SGN-U212961	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: