Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U577960, SGN-U581119, and SGN-U593075 in the current build, Tomato 200607 #2

Unigene SGN-U312399

Unigene Basic Information

Unigene ID:	SGN-U312399
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	312399
mRNA sequence:	Length: 1704 bp

>SGN-U312399 Tomato 200607 #1 (271 members)
CGAGTGGCTGAATACAAATTGTTGGGCGCCCGCGAAGTAGGGATTAAAAGTCAAATTCCTACAAAAATATTCGCTAAAATAAGTCCCAAT
AAAACCAATATATATAGCAGTATTGCGTTCGCCGTTTCGACTCCATTCACCCCTCTTTCTCATATCATCTCCTCGTTCTTCTCCTCTCCA
TCACTACTTTCGAGGCGAGTCGAACGAAGGACTTATTTAAACGTTGCAATGGCAGATATGAATCAGCATCCAACTGTTTTCCAGAAGGCA
GCAAACCAGCTGCACTTGCGCTCTAGTCTATCCCAAGATGTCCATGCTCGCTATGGGGGCGTTCAGCCTGCTATTTACCAGAGGCATTTT
GCTTATGGCAACTACTCCAATGCTGGACTGCAGAGAGGCCAAGCCACTCAGGATCTATCATTGATCACCTCAAACGCCTCACCTGTGTTT
GTGCAGGCTCCTCAAGAGAAAGGATTTGCAGCTTTTGCCACTGACTTTCTCATGGGTGGTGTTTCTGCTGCTGTATCAAAGACCGCTGCT
GCCCCTATTGAGCGTGTGAAACTATTGATCCAAAATCAAGATGAGATGCTCAAGGCTGGTAGGCTCTCAGAACCATACAAGGGAATTGGT
GATTGTTTCGGTAGGACAATTAAGGAAGAAGGTTTTGGGTCTTTATGGAGAGGAAACACTGCTAATGTTATCCGTTATTTCCCCACTCAG
GCCCTGAACTTTGCATTCAAGGACTACTTCAAGAGACTCTTCAACTTCAAGAAGGACCGTGATGGCTACTGGAAGTGGTTTGCTGGAAAC
CTTGCATCAGGAGGTGCTGCTGGTGCTTCCTCTTTGTTCTTTGTCTACTCCTTGGACTATGCTCGTACCCGTCTTGCTAATGATGCCAAG
GCTTCAAAGAAGGGAGGTGAGAGGCAGTTCAATGGTTTGGTTGATGTCTACAGGAAGACACTCAAATCTGATGGAATTGCTGGTCTATAC
CGTGGATTCAACATTTCATGTGTTGGTATCATTGTTTACCGTGGTTTGTACTTTGGAATGTACGACTCCTTGAAGCCTGTCCTCTTGACA
GGAAACCTGCAGGATAGTTTCTTTGCTAGCTTTGCTCTTGGTTGGCTCATCACCAATGGTGCTGGTCTTGCTTCTTACCCCATTGATACA
GTAAGAAGAAGAATGATGATGACATCTGGTGAGGCGGTGAAGTACAAGAGCTCGCTTGATGCATTCTCCCAGATTGTTAAGAATGAGGGT
CCCAAATCTCTGTTCAAGGGTGCTGGTGCTAACATCCTCCGAGCTGTTGCTGGTGCTGGTGTGTTGGCTGGATATGACAAGCTTCAGGTT
CTTGTTTTGGGAAAGAAATACGGATCTGGTGGTGCATAAGTCAGCCTCGTAACATCCTTTAGAATTTAGATGGTGATGAAAATCTTTTTG
GTGTTACATTTGAGTATTCAGTTGGGGAGACATTTATCATTTTTCCTTTTGACTTTTTTTTTGTAATAATTCGAAAAATCTTAGAGTGGG
TCAAAGTTTAAAAACCCCACACTCGTTTCCCTTGTTGAAGGATTATTACTGTTTTGTTTGGGCGGACCTTATTTCAATTGCAGAGCTTAC
AGATTCTGAATGAATCTTTTGATAAAAAAAAAAAAAAAAAAGTTTGGGACTTGTGTTATTTTAAGTGTGGTATATAATATTTTG

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
LEU89839	ADP/ATP translocator

Genomic locations (0)

None

Library representation (35)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPP	pollen pollen collected from open flowers	5426	2
Solanum pennellii	cLPT	leaf trichomes 4-8 weeks old	2729	6
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	50
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	1
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	20
Solanum lycopersicum	LA	Leaf Mature leaves	6589	8
Solanum lycopersicum	LB	Leaf Mature leaves	3316	1
Solanum lycopersicum	LC	Leaf Mature leaves	5712	2
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	5
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	7
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	3
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	6
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	7
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	8
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	18
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	3
Solanum lycopersicum	cLEN	fruit pericarp red ripe to over-ripe	3979	5
Solanum lycopersicum	cLER	leaf 4 weeks	5127	12
Solanum lycopersicum	cLES	leaf 4 weeks	5243	8
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	8
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	4
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	2
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	6
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	6
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	5
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	4
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	10
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	5
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	6
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	16
Solanum lycopersicum	cTOS	suspension cultures	8026	9
Solanum lycopersicum	cTSC	seed	2256	1
Solanum lycopersicum	cTSD	seed	1504	4
Solanum habrochaites	LH_Ea	Glandular Trichomes	3840	9
Solanum habrochaites	cLHT	leaf trichomes 4-8 weeks old	2457	4

mRNA member sequences (271)

Alignment image suppressed for unigene with 271 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (5)

Annotations (manual: 3 | blast: 2 | go: 6 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101398	Mitochondrial substrate carrier - Molecular Function: binding (GO:0005488) - Biological Process: transport (GO:0006810) - Cellular Component: membrane (GO:0016020)	297
2	118462	Mitochondrial substrate carrier - Molecular Function: binding (GO:0005488) - Biological Process: transport (GO:0006810) - Cellular Component: membrane (GO:0016020)	115
5	129139	Mitochondrial carrier protein - Molecular Function: binding (GO:0005488) - Cellular Component: mitochondrial inner membrane (GO:0005743) - Biological Process: transport (GO:0006810) Adenine nucleotide translocator 1 - Molecular Function: transporter activity (GO:0005215) - Cellular Component: mitochondrial inner membrane (GO:0005743) - Biological Process: transport (GO:0006810) Mitochondrial substrate carrier - Molecular Function: binding (GO:0005488) - Biological Process: transport (GO:0006810) - Cellular Component: membrane (GO:0016020)	37

Preceding Unigenes (2)

Unigene	Build
SGN-U212911	Lycopersicon Combined #3
SGN-U232204	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: