Sol Genomics Network

Unigene SGN-U298627

Unigene Basic Information

Unigene ID:	SGN-U298627
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	298627
mRNA sequence:	Length: 474 bp

>SGN-U298627 Solanum tuberosum #4 (1 members)
CTCATACTCCCTGCCTATCACCGCCCTATACTCCGCCGTCAATCTTTTAACCATGAACGCTTCGGAGTCTCCAATTGTACAAAAAGTTCT
AGCAAAAATACCGTGACTTTGCTAGTAAAAGCAATTGATGCTCAAAAGACAAATGAGCAACATGAGAAGGTCAAAAGGGCTTATCCGTTT
CACGAAATTGAACCAAAATGGCAACATTATTGGGAAGAGAATAAGACATTTCGAACCCCTGATGAGATTGATACTTCCAAGCCCAAATTC
TATGTTCTTGATATGTTCCCATATCCAAGTGGAGCTGGTTTGCATGTTGGACATCCGCTTGGATATACTGCGACAGATATCCTTGCTAGA
TTTAAACGCATGCAAGGTTTCAACGTATTGCATCCAATGGGATGGGATGCATTTGGTTTACCTGCTGAGCAATATGCTATTGACACAGGC
ACACATCCAAAAATCACAACTTTG

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	cSTA	Axillary buds of stemp explants; swelling stolons; growing stolons; growing sink-tubers 1 to 3 days (plates 1-20), 4 to 6 days (plates 21-40), 7 to 10 days (plates 41-60)	10537	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E438713
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	385	tRNA-synt_val tRNA-synt_I tRNA-synt_1a Leu-tRNA-synt1a tRNA-synt_ile	44
2	28951	tRNA-synt_val tRNA-synt_I Leu-tRNAsynt1a Leu-tRNA-synt1a tRNA-synt_1a tRNA-synt_ile Homoaconitase tRNA-synt_met	3
5	63477	tRNA-synt_val tRNA-synt_I Leu-tRNAsynt1a Leu-tRNA-synt1a tRNA-synt_1a tRNA-synt_ile Homoaconitase tRNA-synt_met	3
1.1	101679	tRNA synthetase valyl/leucyl anticodon-binding Aminoacyl-tRNA synthetase class 1a anticodon-binding	47
2	123606	Aminoacyl-tRNA synthetase class Ia - Molecular Function: aminoacyl-tRNA ligase activity (GO:0004812) - Molecular Function: ATP binding (GO:0005524) - Biological Process: tRNA aminoacylation for protein translation (GO:0006418) Aminoacyl-tRNA synthetase class I - Molecular Function: aminoacyl-tRNA ligase activity (GO:0004812) - Molecular Function: ATP binding (GO:0005524) - Biological Process: tRNA aminoacylation for protein translation (GO:0006418) Aminoacyl-tRNA synthetase class 1a anticodon-binding ValRS-IleRS-LeuRS editing tRNA synthetase valyl/leucyl anticodon-binding Leucyl-tRNA synthetase bacterial/mitochondrial class Ia - Molecular Function: leucine-tRNA ligase activity (GO:0004823) - Molecular Function: ATP binding (GO:0005524) - Biological Process: leucyl-tRNA aminoacylation (GO:0006429)	4
5	140395		2

Preceding Unigenes (1)

Unigene	Build
SGN-U266359	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: