Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U293931

Unigene Basic Information

Unigene ID:	SGN-U293931
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	293931
mRNA sequence:	Length: 485 bp

>SGN-U293931 Solanum tuberosum #4 (1 members)
AAAGAAAAGAAAGAATGGGTTCCAAAGCATTTCTGTTTCTTGGTCTTTTTTTGGCTATTTTTATAATGATAAGCTCTGAGGTTTTAGCTA
CTGAGTTGGCTGAGAACTCTAAGAAATCTGAAAACAAGAATGAAGTACATGAAGCCCAATATGGTGGACACCCTGGTGGTGGATATGGAC
ACGGTGGTGGTGGATACGGACACGGTGGTGGTGGACGACGTGGAGGATACTGCCGGTACGGTTGCTGCGGCCATGATTACAATGGTTGCT
ATAGGTGTTGCTCCTACAAAGGTGAGGCAATGGACAAAGTTACTCAAGACAAGCCACACAATTAATTTTATTAATTATGTGTGGACTAAT
ATACTATTTTAAAACTTTTGTAATGGCAATTATGTAATATTATTAGTAATGCTCTTTCTACTTTAGACCTTGCTATAATTAGTAAAAATG
TATGAATAAAAGCCATCTTGTAGTAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	cSTB	leaves and petioles 8 weeks old plants	10327	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E474964
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 0 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	3	RNA_rec_mot	1201
2	21977	RNA_rec_mot	370
5	56580	Ribosomal_L29	31
1.1	101362	RNA-binding region RNP-1 (RNA recognition motif) - Molecular Function: nucleic acid binding (GO:0003676)	1383
2	119866	Sulfite reductase ferredoxin dependent - Molecular Function: iron ion binding (GO:0005506) - Molecular Function: heme binding (GO:0020037) - Molecular Function: sulfite reductase (ferredoxin) activity (GO:0050311) Nitrite and sulfite reductase iron-sulfur/siroheme-binding site - Biological Process: electron transport (GO:0006118) Nitrite and sulphite reductase 4Fe-4S region - Biological Process: electron transport (GO:0006118) Ferredoxin-nitrite reductase - Molecular Function: oxidoreductase activity acting on other nitrogenous compounds as donors iron-sulfur protein as acceptor (GO:0016664) - Biological Process: nitrate assimilation (GO:0042128) Nitrite/sulfite reductase flavoprotein alpha-component domains 1 and 3 Nitrite/sulfite reductase hemoprotein beta-component ferrodoxin-like	12
5	130072	Sulfite reductase ferredoxin dependent - Molecular Function: iron ion binding (GO:0005506) - Molecular Function: heme binding (GO:0020037) - Molecular Function: sulfite reductase (ferredoxin) activity (GO:0050311) Nitrite and sulfite reductase iron-sulfur/siroheme-binding site - Biological Process: electron transport (GO:0006118) Nitrite and sulphite reductase 4Fe-4S region - Biological Process: electron transport (GO:0006118) Ferredoxin-nitrite reductase - Molecular Function: oxidoreductase activity acting on other nitrogenous compounds as donors iron-sulfur protein as acceptor (GO:0016664) - Biological Process: nitrate assimilation (GO:0042128) Nitrite/sulfite reductase flavoprotein alpha-component domains 1 and 3 Nitrite/sulfite reductase hemoprotein beta-component ferrodoxin-like	13

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U264693	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: