Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U292712

Unigene Basic Information

Unigene ID:	SGN-U292712
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	292712
mRNA sequence:	Length: 333 bp

>SGN-U292712 Solanum tuberosum #4 (1 members)
GCAAAAGATGGGTATTGGGTACTTAAGGAAAAGTTCACACAAGCATAAATCCAGCTGAAAAGGCGAAATTGAAAAGGAACCTATGAAATT
ATTCACTGAAAATGGTATTGAAAGATCTTGCTAAGATCTCGCTTGAAGAGATGGAGAAATCAAAGCTTACTAAGGAAGATATTGATATTC
GCCTCCAGTGGCTTGGACTCTTCCATCGGAGAAAACACCACTATGGTCGATTCATGATGCGATTGAAGCTTCCAATGGAGTAACGACGAG
TGCTCAAACTCGATACTTAGCTAGTGTGATTAGGAAATATGGGAAAGATGGATGTGGTGATGT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	ACDA	Tubers	5977	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E580821
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	731	Nir_Sir_4Fe4S Nir_sir_fer Nir_Si	26
2	23176	Nir_Sir_4Fe4S Nir_sir_fer Nir_Si	15
5	57342	Nir_Sir_4Fe4S Nir_sir_fer Nir_Si	14
1.1	102206	Nitrite and sulfite reductase iron-sulfur/siroheme-binding site - Biological Process: electron transport (GO:0006118) Nitrite and sulphite reductase 4Fe-4S region - Biological Process: electron transport (GO:0006118) Nitrite/sulfite reductase flavoprotein alpha-component domains 1 and 3 Nitrite/sulfite reductase hemoprotein beta-component ferrodoxin-like Ferredoxin-nitrite reductase - Molecular Function: oxidoreductase activity acting on other nitrogenous compounds as donors iron-sulfur protein as acceptor (GO:0016664) - Biological Process: nitrate assimilation (GO:0042128)	19
2	120151	Nitrite and sulfite reductase iron-sulfur/siroheme-binding site - Biological Process: electron transport (GO:0006118) Nitrite and sulphite reductase 4Fe-4S region - Biological Process: electron transport (GO:0006118) Ferredoxin-nitrite reductase - Molecular Function: oxidoreductase activity acting on other nitrogenous compounds as donors iron-sulfur protein as acceptor (GO:0016664) - Biological Process: nitrate assimilation (GO:0042128) Nitrite/sulfite reductase flavoprotein alpha-component domains 1 and 3 Nitrite/sulfite reductase hemoprotein beta-component ferrodoxin-like	10
5	130665	Nitrite and sulfite reductase iron-sulfur/siroheme-binding site - Biological Process: electron transport (GO:0006118) Nitrite and sulphite reductase 4Fe-4S region - Biological Process: electron transport (GO:0006118) Ferredoxin-nitrite reductase - Molecular Function: oxidoreductase activity acting on other nitrogenous compounds as donors iron-sulfur protein as acceptor (GO:0016664) - Biological Process: nitrate assimilation (GO:0042128) Nitrite/sulfite reductase flavoprotein alpha-component domains 1 and 3 Nitrite/sulfite reductase hemoprotein beta-component ferrodoxin-like	9

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: