Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U292280

Unigene Basic Information

Unigene ID:	SGN-U292280
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	292280
mRNA sequence:	Length: 309 bp

>SGN-U292280 Solanum tuberosum #4 (1 members)
ACACATTGAGTTCTCAAAAAAGAGGTTGGTATTACACATTGATCCAAAAGGGGAATCAACTGAGCCTACCTGTATGAAAAGACAAATAGC
AAGACATAGAATATCACTGGCCTAGATCTCAATCGAAGGTCCATTTCAGCAGCTGCTACTATTCTGAACCATCTGGGAATGCATCCAGAG
CGTCCTGTTTGCCATTGACATAGTACTCAACAACTGCTTTCATTCTAGGAAATTTGTCTGGGTGATAGTTTACATGAACTATAACTGGTT
TCAACTTCTTCAGATTAGCATCTTTTCTTACAGTCTTGA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	STM	mixed tissues	14805	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E417841
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	411	Glyco_trans_8	42
2	23842	Glyco_trans_8	10
5	57913	Glyco_trans_8	10
1.1	101374	Homeodomain-like	561
2	120932	Reticulon - Molecular Function: molecular function unknown (GO:0005554) - Cellular Component: endoplasmic reticulum (GO:0005783)	7
5	131182	Reticulon - Molecular Function: molecular function unknown (GO:0005554) - Cellular Component: endoplasmic reticulum (GO:0005783)	7

Preceding Unigenes (1)

Unigene	Build
SGN-U264340	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: