Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U290833

Unigene Basic Information 
Unigene ID: SGN-U290833
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 290833
mRNA sequence: Length: 274 bp

>SGN-U290833 Solanum tuberosum #4 (1 members)
ATCAATCAGCAATTAATCCAAAACCATAATGGCTGCCAAAAATTCAGAGATGAAGTTTGCTATCTTCTTCGTTGTTCTCTTGACGACCAC
TTTAGTTAATATGCAAGTGATGGCTCTTCGAGACATGCCGCCACAAGAAACATTGCTGAAACATGAAGCTATTTTCCTCAACATGTTTCT
GGGAGCTATGTAACGATTATTGCACCACAAACGCTGATTTGCATCGGAATTCACCTTCTGCCGCATGGTTGTAAAGCTGCAAGAAGTCCC
CCAG

[Blast] [AA Translation]
Associated Loci (4)  
Locus symbolLocus nameGene activity
pft2 metallocarboxypeptidase inhibitor precursor 2metallocarboxypeptidase inhibitor precursor
pft3 metallocarboxypeptidase inhibitor 3
mcpi metallocarboxypeptidase inhibitormetallocarboxypeptidase inhibitor
pft1 metallocarboxypeptidase inhibitor 1metallocarboxypeptidase inhibitor
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E565511
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)