Sol Genomics Network

Unigene SGN-U287737

Unigene Basic Information

Unigene ID:	SGN-U287737
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	287737
mRNA sequence:	Length: 625 bp

>SGN-U287737 Solanum tuberosum #4 (1 members)
GAGTTCAAACCTGAGACTTATGCCTTGTTTAGTTTAAAGGTACTCATTAGTTCACAAGAAGACTACTTTCAATGCAATAGTAGGAAACCA
GGGTCTCGTACCTTCTTGCCTCGTATAACAGCTCCTGCCTCCCCTTGAATCACCATATACTTTGTTCCCCCAAGATATAAACCAGTTGGA
GCAAGTGTTCCAGGTTCGGCAAAGTCATTCATTATGGCTGTTATTTCTTCTGGTTTAAACTGCCAAAAAAAGTACACCATTATTGACAAA
CTCACCAAGTTAGTTTCTTGTCGGTGCAACTCTACATCGCTTCCAACAAGCCTTCTCCCACAGGAATGGCATTGGGTAGTTTAGTAAATG
AAGAAATTTATTAAGTTAATATGAACCATGCAAAAAAAATATTAACACCAAAAGACTCCCTTATAGATACACCAAACTATCAAATTCATT
ATTAAAAATCCAATTTTTAACATGCAATTTAAACACAAGTACAAATGAAAAGCTTAAGAAATAACAATATTCAGGTCTTTTTCTTCAAGT
GTATACAACAATTCGATTGCCAACTCATGCTGAATCAGTAGTTTTCCTATTTATTGACTGTGGCAAAAATATTAGGTTTGCATAA

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
profilin	profilin	profilin

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	STM	mixed tissues	14805	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E428635
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	535	Profilin_plant Profilin	34
2	22444	Profilin_plant Profilin	29
5	56615	Profilin_plant Profilin	29
1.1	101894	Profilin/allergen - Molecular Function: actin binding (GO:0003779) - Biological Process: cytoskeleton organization and biogenesis (GO:0007010) - Cellular Component: actin cytoskeleton (GO:0015629) Plant profilin - Molecular Function: actin binding (GO:0003779) - Biological Process: actin cytoskeleton organization and biogenesis (GO:0030036)	30
2	118790	Plant profilin - Molecular Function: actin binding (GO:0003779) - Biological Process: actin cytoskeleton organization and biogenesis (GO:0030036) Profilin/allergen - Molecular Function: actin binding (GO:0003779) - Biological Process: cytoskeleton organization and biogenesis (GO:0007010) - Cellular Component: actin cytoskeleton (GO:0015629)	30
5	129225	Plant profilin - Molecular Function: actin binding (GO:0003779) - Biological Process: actin cytoskeleton organization and biogenesis (GO:0030036) Profilin/allergen - Molecular Function: actin binding (GO:0003779) - Biological Process: cytoskeleton organization and biogenesis (GO:0007010) - Cellular Component: actin cytoskeleton (GO:0015629)	30

Preceding Unigenes (1)

Unigene	Build
SGN-U259742	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: