Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U287721

Unigene Basic Information

Unigene ID:	SGN-U287721
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	287721
mRNA sequence:	Length: 686 bp

>SGN-U287721 Solanum tuberosum #4 (1 members)
AATCTCAGTAGAATCCACACCAGCAGATCCAATTCTCTTCCCCATTTGTGTCTCCTTTCTTCCTAAACCCTAACCCTAGTTCTCTCCCTA
CTTGGGAATTCATTTCTTCGCTTAGAAATGGCCACTGAAGAACCAGTCATCGCTAACGAGGTTGTTGAAGAGCAAGCCGCTCCTGAACCT
GTCAAGGATGAGGCAAATCCTCCGGCTAAGTCTGGGAAATTAAAGAAAGAGACCAAGGCGAAGAAGCCTGCTGCACCGAGGAAGAAAAGT
GCTCCTCCGGCACATCCTCCTTACTTTGAGGTAATTGAAAATTGAACTTTCAGTTTTGTTAATTATACTTGATGATAAGATTCTTTTGTG
CTTTGTGAATGTGTATTGAAGTTAATTTTGGATTGTATCGTGCAGATGATTAAGGATGCGATTGTGACATTGAAGGAGAGAACTGGATCC
AGCCAGTACGCTATTACCAAGTTCATTGAGGAAAAGCAGAAGAATCTTCCATCCAATTTCAAAAAATCATTGCTTATCCAGTTGAAGAAG
TTTGTTGCTTCTGAGAAGCTGGTGAAAGTGAAGAACTCTTACAAGCTTCCATCGGGTTCTAAGCCTGCTGCTGCTGCTGCCCCGGCGAAG
AAGAAGCCTGCTGCGGCAAAGTCAAAGCCCGCTGTTGAGCCCAAGTCCAAGCCTGC

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	SWST	Stolon	5942	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E560227
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	110	Myb_DNA_binding	121
2	22376	Histone_H1/H5	32
5	56797	Linkerhist_N Histone_H5 Histone_H1/H5	22
1.1	101473	Myb DNA-binding - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634)	112
2	118777	Histone H5 - Cellular Component: nucleosome (GO:0000786) - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634) - Biological Process: nucleosome assembly (GO:0006334) Winged helix repressor DNA-binding Histone H1/H5 - Cellular Component: nucleosome (GO:0000786) - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634) - Biological Process: nucleosome assembly (GO:0006334) Linker histone N-terminal - Cellular Component: nucleosome (GO:0000786) - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634) - Biological Process: nucleosome assembly (GO:0006334) - Biological Process: chromosome organization and biogenesis (sensu Eukaryota) (GO:0007001)	30
5	129393	Histone H5 - Cellular Component: nucleosome (GO:0000786) - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634) - Biological Process: nucleosome assembly (GO:0006334) Winged helix repressor DNA-binding Histone H1/H5 - Cellular Component: nucleosome (GO:0000786) - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634) - Biological Process: nucleosome assembly (GO:0006334) Linker histone N-terminal - Cellular Component: nucleosome (GO:0000786) - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634) - Biological Process: nucleosome assembly (GO:0006334) - Biological Process: chromosome organization and biogenesis (sensu Eukaryota) (GO:0007001)	22

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U259611	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: