Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U286659

Unigene Basic Information

Unigene ID:	SGN-U286659
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	286659
mRNA sequence:	Length: 658 bp

>SGN-U286659 Solanum tuberosum #4 (1 members)
CTTTTTATACTTTTAATTTTTTCTCTTATTCATCATCATGATTAGTCAAATTAAGAGTGGAATATTTGGTCCCCCTGATGGCTCAAAGAA
ACTTAAAGGAACTGTGGTGATGATGAACAAAAATGCTCTAGGGTTTACTGATCTTGCTGGTTCTTTGACTGATACAGCCTTTGATGTCCT
TGGCCAAAAGGTTTCTTTTCAATTAATTAGTTCTGTTCAAGCAAATGGTTTACAAGGGAAGCACAGCAATCCAGCCTACTTGGAGAACTC
TCTCTTTACTCTACCACCATTAACAGTAGATGAAACATCCTTTGGTGTCACATTTGATTGGAATGAGGAGTTTGGAGTTCCAGGTGCATT
TATCATCAAAAATACGCATATCAATGAGTTCTTTCTCAAGTCACTCACACTTGAAGATGTGCCTAATCATGGCAAGGTCCATTTTGTTTG
CAATTCTTGGGTTTATCCTTCTTTTAGTTACAAGTCAGATCGCATTTTCTTTTGTAATCAGCCATATCTCCCAAGTAAAACACCAGAGCT
TTTGCGAAAATACAGAGAAAATGAATTGCTAACATTAAGAGGAGATGGAACTGGAAAGCGCGAGGCGTGGGATANNGATTATGACTATGA
TATNCTACATGACTTGGGTAATCCTGAT

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
lox1	lipoxygenase 1	lipoxygenase

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	cSTE	periderm and subperiderm 24 and 48 hour, and 5 and 7 day	5425	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E482997
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	3	RNA_rec_mot	1201
2	22092	Plant_lipoxygnse Lipoxygenase Lipoxygenase_LH2	71
5	56340	Plant_lipoxygnse Lipoxygenase Lipoxygenase_LH2	69
1.1	101576	Lipoxygenase LH2 Lipase/lipooxygenase PLAT/LH2 Lipoxygenase - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) - Molecular Function: lipoxygenase activity (GO:0016165) Plant lipoxygenase - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) - Molecular Function: lipoxygenase activity (GO:0016165)	70
2	118518	Lipase/lipooxygenase PLAT/LH2 Plant lipoxygenase - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) - Molecular Function: lipoxygenase activity (GO:0016165) Lipoxygenase - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) - Molecular Function: lipoxygenase activity (GO:0016165) Lipoxygenase LH2	69
5	129021	Lipase/lipooxygenase PLAT/LH2 Plant lipoxygenase - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) - Molecular Function: lipoxygenase activity (GO:0016165) Lipoxygenase - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) - Molecular Function: lipoxygenase activity (GO:0016165) Lipoxygenase LH2	61

Preceding Unigenes (1)

Unigene	Build
SGN-U259050	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: