Sol Genomics Network

Unigene SGN-U276063

Unigene Basic Information

Unigene ID:	SGN-U276063
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	276063
mRNA sequence:	Length: 1180 bp

>SGN-U276063 Solanum tuberosum #4 (5 members)
CACCACTCTTCCTCGCCTACGAACTTCCTCACCCCCATTCTCCTCCTCCTTCCGATCTCTTTCTCCGGCCAAATTCATCTCCATAAGGAG
AACATTATATGACAGTACAGGATAGAGAAAGATCATGGCTGTAGAGGCTTTTGCCAAAACAAATTTGATGGAAGATATTGATGATGACGA
TGACATGCCTTTAGTTTTCAAACGAAGTAGTACCACATCAAAGCAGAATCAGTCCAATTCATCATCTCAGAGGCAGGATGGAAGATTGGG
GCGGCAAGTTCCTGATGTACGTTCTCCTAATGGCCAGAGCTCTAGTACTCATAAAGTTAAGACAGCCGCCTCTTCTAAGGCATCTCCAGC
AGTTTCACCTTTAACTAGTCCGAAAGCATCGCCTCTGTCAAGCAGGACATCTCCTGCACCAAACTCCAGGACATCTCCTGCACCAAACTC
AAGGCCGTCATCTTCTGCAGGTAATCAAGCAAAAAATGTTAATCAACAATCCAATATTGCTCCTAAGGAGTCGAAGCAAGCTGTTGAACC
AAAATCTGAACCTAATGATGAAGCTGAGGATTCTGAAGATGATAAACCATTGAGTGCTAGGGTCCCTTCTGGGTTATCTAAGAGCAATTC
TATTCATGCCAACAACGTGCTTGGTACTTCAACATCAGTTCAGAAGTCTAGACCTCCCAAAAAAGAGGATTCAGATGATGAAATTCCCTT
AGCATCAAGGTTTCAAATGAAATCCAGTGCAGGGGCTTCCACTAGCAAGTTTTCTAGTTCTGAAGAAGTTAAGCCTAAGATTCGTCAAAA
TGGTTTGCCATCTGCGACAGTTTTAAGTAAGAGACCCCCTGGTGAGGTCAAGCCTGCTGCTCAGGCTTCAGTTAAAAAGCCTAGACTTTC
TGATGCATCTACACCTGTTTCTAGTAAGCAACCGTCTGTTAAAACTGAAAAGAAGACAGAGGACGATGACGATGAAGTTCCTTTATCTCA
GAGAATAAAAAAGGCAGTAGCTTCAGCTTCAGCTTCAGCTAGTAAAGTGTCATCTGTGAAGAAAGCAACTAAAGTTGTTTCGTCATCGAT
GAAGAAAACAAAGAAGAAGTTGAAAAAACCCAAGTACTCTAAGTCGTCAAAACTGCAGCCAAGCTCTGGTGATGGGCAAAAATGGACTAC
ATTGGAACAC

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (4)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	STM	mixed tissues	14805	1
Solanum tuberosum	cPRO	roots in vitro grown stem cuttings	10187	1
Solanum tuberosum	cSTA	Axillary buds of stemp explants; swelling stolons; growing stolons; growing sink-tubers 1 to 3 days (plates 1-20), 4 to 6 days (plates 21-40), 7 to 10 days (plates 41-60)	10537	2
Solanum tuberosum	cSTS	sprouting eyes from tubers 12-14 weeks post harvest	9230	1

mRNA member sequences (5)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	1774	Topismerse_I Topoisomer_I_N	10
2	23791	Topismerse_I Topoisomer_I_N	10
5	58586	Topismerse_I Topoisomer_I_N	8
1.1	101515	Protein of unknown function DUF1216	92
2	120850	DNA topoisomerase I C-terminal - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase type I activity (GO:0003917) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) DNA topoisomerase I DNA binding eukaryotic-type - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase type I activity (GO:0003917) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) DNA topoisomerase I C-terminal eukaryotic-type - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) DNA breaking-rejoining enzyme catalytic core - Molecular Function: DNA binding (GO:0003677) DNA topoisomerase I catalytic core eukaryotic-type - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268)	8
5	131096	DNA topoisomerase I C-terminal - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase type I activity (GO:0003917) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) DNA topoisomerase I DNA binding eukaryotic-type - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase type I activity (GO:0003917) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) DNA topoisomerase I C-terminal eukaryotic-type - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) DNA breaking-rejoining enzyme catalytic core - Molecular Function: DNA binding (GO:0003677) DNA topoisomerase I catalytic core eukaryotic-type - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268)	8

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U248965	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: