Sol Genomics Network

Unigene SGN-U269693

Unigene Basic Information

Unigene ID:	SGN-U269693
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	269693
mRNA sequence:	Length: 672 bp

>SGN-U269693 Solanum tuberosum #4 (30 members)
CCGGCCACATTTGCAGAGAGGGAGCGTGAGAGAGAAATCGGCGAAGATGAAGTACAATCCAAGAGTATCCTCCTCCCGCCGCAAGAGCAG
GAAGGCACATTTCACGGCGCCTTCCAGCCTTCGTCGGGTGTTGATGAGCGCCCCTTTGTCCTCAGAGTTGCGAACCAAGTACAGCGTTAG
GTCCATGCCGGTAAGGAAAGACGACGAGGTTCAGGTGGTTCGTGGAACCTACAAGGGCCGTGAAGGAAAAGTTGTCCAAGTTTACCGTAA
GAAGTGGGTGATCCACATTGAGCGCATTACCAGAGAGAAGGTTAATGGATCCACTGTTAACGTTGGTATTCACCCATCCAAGGTCGTCAT
CTCCAAACTCAGGCTCGACAAGGACCGTAGGTCTCTACTTGACCGTAAGGCTAAGGGTCGTGCTGCTGCCGATAAGGATAAGGGTACTAA
GTTCACCGCCGAGGAGATCATGCAGACAATTGATTAGTCCTTCTTCTATCTATTGTGTTTTCTGTTTTGTTATATCTTATTGCTCTTGCT
ACTTTGAAGCTTGTTGGAATAGCTAAAGAGTATTTTTTCTGAGACTCCCTGAATTTTGTTTAAGTATTTTAATAGTATGCAATTTTGGGT
AAAAAAAAAAAAAAAAAAAAAAACTCGGAGACTAGTTCTCTC

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (15)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	ACDA	Tubers	5977	1
Solanum tuberosum	ACDC	Sprouting Tubers	5177	2
Solanum tuberosum	CSCH	Tubers	5038	3
Solanum tuberosum	CSWB	Tubers	6124	3
Solanum tuberosum	IVROOT	Root	5850	1
Solanum tuberosum	MXFL	Floral buds	6603	3
Solanum tuberosum	MXLF	Leaves	6585	1
Solanum tuberosum	PPC	leaf 6 week old	5062	1
Solanum tuberosum	SLMW	Assorted Stolon/Tuber Developmental Series	1368	2
Solanum tuberosum	STOL	Stolon	6462	2
Solanum tuberosum	TBSK	Tuber Skin	4812	2
Solanum tuberosum	cPRO	roots in vitro grown stem cuttings	10187	3
Solanum tuberosum	cSTA	Axillary buds of stemp explants; swelling stolons; growing stolons; growing sink-tubers 1 to 3 days (plates 1-20), 4 to 6 days (plates 21-40), 7 to 10 days (plates 41-60)	10537	2
Solanum tuberosum	cSTE	periderm and subperiderm 24 and 48 hour, and 5 and 7 day	5425	1
Solanum tuberosum	cSTS	sprouting eyes from tubers 12-14 weeks post harvest	9230	3

mRNA member sequences (30)

Alignment image suppressed for unigene with 30 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 5 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	216	S-AdoMet_synt	69
2	23089	KOW Ribosomal_L24 Ribosomal_L24_26 Ribosomal_L26e/a	16
5	57177	KOW Ribosomal_L24 Ribosomal_L24_26 Ribosomal_L26e/a	16
1.1	101580	S-adenosylmethionine synthetase - Molecular Function: methionine adenosyltransferase activity (GO:0004478) - Molecular Function: ATP binding (GO:0005524) - Biological Process: one-carbon compound metabolism (GO:0006730)	69
2	119270	Ribosomal protein L24/L26 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) KOW Ribosomal protein L26 eukaryotic and archaeal form - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: large ribosomal subunit (GO:0015934) Translation protein SH3-like KOW (Kyrpides Ouzounis Woese) motif	18
5	129617	Ribosomal protein L24/L26 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) KOW Ribosomal protein L26 eukaryotic and archaeal form - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: large ribosomal subunit (GO:0015934) Translation protein SH3-like KOW (Kyrpides Ouzounis Woese) motif	18

Preceding Unigenes (1)

Unigene	Build
SGN-U245391	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: