Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U269177

Unigene Basic Information

Unigene ID:	SGN-U269177
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	269177
mRNA sequence:	Length: 791 bp

>SGN-U269177 Solanum tuberosum #4 (35 members)
AGTCGTTCTCTCTCTCTCTTTTCACAAGCACCTACAGCGAGAGCAGAAGAAGAAAATGCCGGCCGGTCATGGTTTGAGGTCTCGAACGAG
AGATTCATTCTCTCGCGCCTTCAGGAAGAAGGGTACCATCGCACTTTCAACCTACTTGAGGATTTTCAAAATCGGAGATTATGTTGATAT
CAAGGTGAATGGTGCTATTCACAAGGGAATGCCTCACAAGTTCTACCATGGACGTACTGGTCGTGTTTGGAATGTTACCAAACGCGCCGT
TGGTGTTGAAGTCAACAAGCAGGTTCGTAACAAGATCTTAAGAAAGAGGATCCATGTGAGGATTGAGCACGTCCAGCAATCTCGATGCAC
TGAAGAAGTCAGGGAAAGGATTAAGAAGAATGATCAACTAAAGGCTGATGCCAAGGCTAGAGGAGAAATCATCAGCACAAAAAGACAACC
ACTCGGACCCAAACCAGGGTTTATGGTTGGAGGTGCTACTTTGGAGACAGTTACCCCCATACCATATGATGTGGTTAATGATTTGAAGGG
AGGTTATTGATCTTAGTCTGTTTCTGAGAGGTGTTGTTTTTTTCTATTTGCGTTTCTGAAATTGAAAGACAGAATTAGTTTTGTTGGTGT
CAACTCCAGACATTGCTTGTTAGTTAAATTTTGTTTACATTGCCATTAGAGGCCTTTGTTGAACTTTTACTACAAAAGTGAAGTCAAGTA
TGTCTATCTATTGCCTAAAAAAAAAAAATTTTAAGATGATTTTTTTAAAAAAAAAAAAAAAAAAAAACTCG

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
DQ191668	60S ribosomal protein L21

Genomic locations (0)

None

Library representation (12)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	ACDC	Sprouting Tubers	5177	2
Solanum tuberosum	IVROOT	Root	5850	1
Solanum tuberosum	MXLF	Leaves	6585	1
Solanum tuberosum	PPC	leaf 6 week old	5062	2
Solanum tuberosum	STOL	Stolon	6462	2
Solanum tuberosum	SWST	Stolon	5942	4
Solanum tuberosum	TBSK	Tuber Skin	4812	2
Solanum tuberosum	cPRO	roots in vitro grown stem cuttings	10187	7
Solanum tuberosum	cSTA	Axillary buds of stemp explants; swelling stolons; growing stolons; growing sink-tubers 1 to 3 days (plates 1-20), 4 to 6 days (plates 21-40), 7 to 10 days (plates 41-60)	10537	2
Solanum tuberosum	cSTB	leaves and petioles 8 weeks old plants	10327	4
Solanum tuberosum	cSTE	periderm and subperiderm 24 and 48 hour, and 5 and 7 day	5425	1
Solanum tuberosum	cSTS	sprouting eyes from tubers 12-14 weeks post harvest	9230	7

mRNA member sequences (35)

Alignment image suppressed for unigene with 35 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 4 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	1153	Ribosomal_L21e	16
2	23024	Ribosomal_L21e	16
5	57112	Ribosomal_L21e	16
1.1	102368	Ribosomal protein L6 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Translation protein SH3-like Ribosomal protein L21e - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	15
2	119451	Ribosomal protein L6 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein L21e - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Translation protein SH3-like	15
5	129777	Ribosomal protein L6 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein L21e - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Translation protein SH3-like	15

Preceding Unigenes (1)

Unigene	Build
SGN-U243863	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: