Sol Genomics Network

Unigene SGN-U268497

Unigene Basic Information

Unigene ID:	SGN-U268497
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	268497
mRNA sequence:	Length: 671 bp

>SGN-U268497 Solanum tuberosum #4 (3 members)
ATTTCATCACACAAGAACCAGTCTCCACCGGTTCTATACCTTTTTTCCTAAAGAAAAATGGCATCTCACGTTGTTGGATATCCCCGTATG
GGCCCAAAGAGAGAGCTGAAATTCGCTCTCGAGTCTTTCTGGGATGGAAAGAGCAGTGCTGAGGATTTGAAGAAGGTCTCTGCAGACCTC
AGGTCATCCATCTGGAAACAGATGTCTGCTGCTGGCATTAAGTACATTCCCAGCAACACATTCTCTTACTATGATCAGGTGCTCGACACA
ACCGCAATGCTTGGTGCTGTCCCATCTAGGTACAACTGGACCGGTGGTGAGATTGAGTTCGGTACTTACTTCTCGATGGCCAGAGGAAAT
GCCTCTGTCCCTGCTATGGAGATGACCAAGTGGTTTGACACCAACTACCACTTCATCGTCCCTGAGTTGGGACCTGATGTTAACTTTTCT
TATGCTTCCCAATGGATGGGTTCAATCTTATGGATCTCGATGTGTGAAGCCACCAATCATCTATGGTGATGTGAGCCGCCCTAAGCCAAT
GACCGTCTTCTGGTCCTCAAAAGCTCAAGAGATGACCAAGAGGCCAATGAAGGGAATGCTTACTGGCCCTGTCACCATTCTTAACTGGTC
TTTTGTCAGAAATGACCAACCTAGGTTTGAGACTTGCTACC

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
ms	methionine synthase	methionine synthase

Genomic locations (0)

None

Library representation (3)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	STM	mixed tissues	14805	1
Solanum tuberosum	cSTD	dormant tuber one month post harvest	5045	1
Solanum tuberosum	cSTS	sprouting eyes from tubers 12-14 weeks post harvest	9230	1

mRNA member sequences (3)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	862	Met_syn_B12ind Methionine_synth	22
2	22675	Met_syn_B12ind Methionine_synth	22
5	56867	Met_syn_B12ind Methionine_synth	21
1.1	102007	Methionine synthase vitamin-B12 independent - Molecular Function: 5-methyltetrahydropteroyltriglutamate-homocysteine S-methyltransferase activity (GO:0003871) - Biological Process: methionine biosynthesis (GO:0009086) Cobalamin-independent synthase MetE N-terminal Prismane-like 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase - Molecular Function: 5-methyltetrahydropteroyltriglutamate-homocysteine S-methyltransferase activity (GO:0003871) - Biological Process: methionine biosynthesis (GO:0009086)	25
2	118935	Cobalamin-independent synthase MetE N-terminal Prismane-like 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase - Molecular Function: 5-methyltetrahydropteroyltriglutamate-homocysteine S-methyltransferase activity (GO:0003871) - Biological Process: methionine biosynthesis (GO:0009086) Methionine synthase vitamin-B12 independent - Molecular Function: 5-methyltetrahydropteroyltriglutamate-homocysteine S-methyltransferase activity (GO:0003871) - Biological Process: methionine biosynthesis (GO:0009086)	25
5	129356	Cobalamin-independent synthase MetE N-terminal Prismane-like 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase - Molecular Function: 5-methyltetrahydropteroyltriglutamate-homocysteine S-methyltransferase activity (GO:0003871) - Biological Process: methionine biosynthesis (GO:0009086) Methionine synthase vitamin-B12 independent - Molecular Function: 5-methyltetrahydropteroyltriglutamate-homocysteine S-methyltransferase activity (GO:0003871) - Biological Process: methionine biosynthesis (GO:0009086)	24

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U243399	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: