Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.


This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been superseded by SGN-U588665 in the current build, Tomato 200607 #2
Unigene SGN-U232618

Unigene Basic Information 
Unigene ID: SGN-U232618
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 232618
mRNA sequence: Length: 179 bp

>SGN-U232618 Lycopersicon Combined #3 (1 members)
GAACCACTTGATAATCTGTTACAACCCTTTACTAAGGATCAACTTACATCTCTTATTAAAGAAGCTTTAGCTAAATACCCTGATTTCAAA
GAAAATATTCAAAAATTGGCTGATAAAGATCCGGCACACCGGAAAATCTTTGTTCATGGTTTAAGTTGGGATACAACAGCTGAATCGCT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E257907
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)