Sol Genomics Network

This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been superseded by SGN-U586021 in the current build, Tomato 200607 #2

Unigene SGN-U213667

Unigene Basic Information

Unigene ID:	SGN-U213667
Unigene Build:	Lycopersicon Combined #3
Date:	2004-06-30
Organism:	S.lycopersicum S.habrochaites S.pennellii
Alternative ID:	213667
mRNA sequence:	Length: 838 bp

>SGN-U213667 Lycopersicon Combined #3 (59 members)
TGCAGCCATTTCTCCATCTCTCTCAGCAGAGTCCAGCCAGCCATGGGTATCGATCTGAAGGCCGGAGGTAAGAGTAAGAAGACTAAGCGT
ACCGCCCCTAAGTCTGACGATGTTTACCTCAAGCTCCTCGTCAAGCTTTACCGATTCTTGGCAAGGAGGACCGGAAGCAAGTTCAATGCG
GTGATACTTAAGAGGCTCTTCATGAGCAAGATTAACAAGCCTCCACTTTCTCTCTCGAGGTTGATTTCTTATGCTGAAGGAAAGGGCGAT
AAGACTGTTGTCCTTGTGGGAACTGTTACCGACGATGTTAGGGCTTATGAAGTTCCAAAATTGAAGGTGTGTGCTTTGAAGTTCACAAAG
ACAGCCAGGGCAAGGATTGAGAAGGCTGGGGGCGAATGCTTGACATTCGATCAGTTGGCTCTCAGGGCTCCACTTGGACAGAACACGCTT
CTCCTCAGAGGTCCAAAGAATGCACGTGAAGCAGTGAAGCACTTTGGTCCAGCTCCAGGTGTTCCACACAGCCATACCAAACCATATGTG
CGTGCCAAGGGAAGAAAGTTTGAGAGAGCTAGAGGAAAGAGGAAGAGCAGGGGTTACAAGGCTTAAGTTGATTTCTATTATTTATCTCAG
AATGGTTGTTATTTGTATCGTGGCAGTACAAGTTTTGCAGACTCTAGTATGCAGTTGCTTATGTTTGCTCCCGTCTTGTTGAGAATACTT
TATTTTTATCTACTTTGAAACCAACTTTTAGTTTAAAAAAAAAAAAAAAAAAAGTTTATTGTTGAGCAAAAATCATATAATATGACTAGT
TGTTACACATTAAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (20)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPT	leaf trichomes 4-8 weeks old	2729	3
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	1
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	3
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	2
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	3
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	1
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	19
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	3
Solanum lycopersicum	cLEN	fruit pericarp red ripe to over-ripe	3979	2
Solanum lycopersicum	cLES	leaf 4 weeks	5243	1
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	2
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	1
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	1
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	1
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	2
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	3
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	1
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	3
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	4
Solanum lycopersicum	cTOS	suspension cultures	8026	3

mRNA member sequences (59)

Alignment image suppressed for unigene with 59 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 1 | blast: 2 | go: 4 )

Protein prediction analysis (1)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	939	Ribosomal_L15 Ribosomal_L18e	20
2	22754	Ribosomal_L15 Ribosomal_L18e	20
5	56899	Ribosomal_L15 Ribosomal_L18e	20

Preceding Unigenes (1)

Unigene	Build
SGN-U144144	Lycopersicon Combined #2

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: