Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been superseded by SGN-U579906 in the current build, Tomato 200607 #2

Unigene SGN-U213041

Unigene Basic Information

Unigene ID:	SGN-U213041
Unigene Build:	Lycopersicon Combined #3
Date:	2004-06-30
Organism:	S.lycopersicum S.habrochaites S.pennellii
Alternative ID:	213041
mRNA sequence:	Length: 1132 bp

>SGN-U213041 Lycopersicon Combined #3 (132 members)
AAGAAATGGCAATACAAATGCATATACAAAACATACAAAGTTTTCAACTCAGCCTTAAAACTACATTGCCATTTCTCCCAATAATCACCA
ACAAACTCTTCAAATTGGAAAAAATGGCAACCGTGACAACACAAGCTTCCGCCGCCATTTTCCGGCCGTGTGCTTCAAGAACCAGGTTCC
TTACTGGATCATCTGGAAAGTTAAACAGGGAGGTCTCTTTTAGACCTTCAACTTCTTCGTCTTACAACTCATTCAAGGTTGAAGCTAAGA
AAGGTCAATGGCTTCCTGGCTTAGCCTCTCCTGATTATCTTGATGGCAGTCTCCCAGGAGACAATGGTTTTGATCCATTGGGACTTGCGG
AGGACCCAGAGAACTTGAAATGGTTCATCCAGGCTGAACTGGTGAATGGTCGTTGGGCTATGTTGGGTGTTGCAGGGATGCTGTTGCCTG
AAGTTTTCACTAGCATTGGGATACTTAATGTGCCCAAATGGTACGATGCTGGAAAATCAGAGTACTTTGCATCATCATCCACCCTGTTTG
TGATCGAGTTCATCTTGTTCCACTACGTCGAGATCAGAAGGTGGCAAGACATTAAGAACCCAGGAAGTGTCAACCAAGACCCTATCTTCA
AGAACTACAGCTTGCCTCCTAATAAATGTGGATACCCTGGTGGTATTTTCAACCCACTCAACTTTGCACCAACTGAAGAGGCCAAGGAGA
AGGAACTTGCTAATGGGAGATTGGCTATGTTGGCATTTTTGGGATTTATAGTGCAGCACAATGTGACTGGGAAGGGACCTTTTGACAACC
TTCTGCAGCACCTCTCTGACCCATGGCACAACACCATCATCCAAACACTCAGCAACTAGAAAACCATCATCAGAAACTTAATTGAATATA
TATTGTTACCTTGTAACCATGTTATGAATTTTGATCAAGAATAGAGCTTTGTGGTAAAACAAGGAACCTTCCTTTAATGTACAGCGTTTC
TTATTCGTGTTATTCCTACTAGATCATCAAAAGAATGTGATTTTGCGCTCTTGTTAGCATATAAAAAAAAAAAAAAAAAACTTTTCTTTT
ATTTAGTTTGATTTGCATCTTAACTGAAAAAAAAAAAAAAAAAACTCGCGGC

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (16)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPT	leaf trichomes 4-8 weeks old	2729	2
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	4
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	4
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	1
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	1
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	10
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	4
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	22
Solanum lycopersicum	cLER	leaf 4 weeks	5127	13
Solanum lycopersicum	cLES	leaf 4 weeks	5243	9
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	21
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	6
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	11
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	11
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	1
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	12

mRNA member sequences (132)

Alignment image suppressed for unigene with 132 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (3)

Annotations (manual: 2 | blast: 2 | go: 2 )

Protein prediction analysis (1)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	57	Chloro_ABbind	219
2	21999	Chloro_ABbind	201
5	57021	Chloro_ABbind	18

Preceding Unigenes (1)

Unigene	Build
SGN-U143588	Lycopersicon Combined #2

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: