Sol Genomics Network

Notice: the solgenomics has been unstable, we apologize for the inconvenience.

Unigene SGN-U211269

Unigene Basic Information

Unigene ID:	SGN-U211269
Unigene Build:	Petunia hybrida #1
Date:	2004-03-30
Organism:	P.hybrida
Alternative ID:	211269
mRNA sequence:	Length: 420 bp

>SGN-U211269 Petunia hybrida #1 (1 members)
GCACGAGGAAGAATATGGTAGTAAAAATATTATTATAGCCGCCCCTCAGCACACCAAAATATTTTTAGTCAATATCCAATTACTATATAT
ATCTTGAAAAGTCCTTCAATTTCCAGAACCCTACTAATTCTTGTTTACTGAGCCAAGGCATATAACATGGCCTTGATGTCTCAGGCAGGT
TCTACACATTGTGTTCACTCTGAAAAGATAAGATGTATAGGTGGACATGGTGGCATCACAAACAATATGGAGATGTTCAAAAAGGAGACA
TTCTTCGGCGTGCATACTTCTTCGCGGAATTCCTCTAAAGTAATGCGAGGGATTTATTTGGATCGCGTTGGACTGGAACGTAAACGAGGA
AGCCTGGCAATTGTTGCTGCTAGTCCTCCAACAGAGGATGCCGTTGTTGCAGCAGAGCCA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Petunia x hybrida	Petunia-PP	all floral organs anthesis	1824	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E528722
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 1 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	2152	Glut_cys_lig_pl	8
2	24347	Glut_cys_lig_pl	8
5	58394	Glut_cys_lig_pl	8
1.1	103337	Glutamate--cysteine ligase GCS2 - Molecular Function: glutamate-cysteine ligase activity (GO:0004357) - Biological Process: glutathione biosynthesis (GO:0006750) Glutamate--cysteine ligase plant - Molecular Function: glutamate-cysteine ligase activity (GO:0004357) - Biological Process: glutathione biosynthesis (GO:0006750) - Cellular Component: chloroplast (GO:0009507)	7
2	121228	Glutamate--cysteine ligase GCS2 - Molecular Function: glutamate-cysteine ligase activity (GO:0004357) - Biological Process: glutathione biosynthesis (GO:0006750) Glutamate--cysteine ligase plant - Molecular Function: glutamate-cysteine ligase activity (GO:0004357) - Biological Process: glutathione biosynthesis (GO:0006750) - Cellular Component: chloroplast (GO:0009507)	7
5	131464	Glutamate--cysteine ligase GCS2 - Molecular Function: glutamate-cysteine ligase activity (GO:0004357) - Biological Process: glutathione biosynthesis (GO:0006750) Glutamate--cysteine ligase plant - Molecular Function: glutamate-cysteine ligase activity (GO:0004357) - Biological Process: glutathione biosynthesis (GO:0006750) - Cellular Component: chloroplast (GO:0009507)	7

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: