Sol Genomics Network

Unigene SGN-U210604

Unigene Basic Information

Unigene ID:	SGN-U210604
Unigene Build:	Petunia hybrida #1
Date:	2004-03-30
Organism:	P.hybrida
Alternative ID:	210604
mRNA sequence:	Length: 628 bp

>SGN-U210604 Petunia hybrida #1 (1 members)
CAAAAATGTCAATCATTTCATCTTCTGCAACTCTGTCTTTATCCCTTACAACAAAGCCCATTTCATCTGTTTCAAAATCCACCAAGATTC
AAACTTTATTTTCCTCTACCAACTCATTGTTCTTCAACAGCAACAAGGCACTGTTTGCTGCAAGAAAAGTAGTAGTAAGTAGGAAAAAGG
GACTTTCTTGTAACTGCTTATTTGGGCTTGGAGTGCCTGAACTAGTAGTCATTGCTGGTGTTGCTGCCCTTCTTTTTGGTCCAAAACAGT
TGCCTGAAGTTGGTCGCTCTATTGGTAAAGTTGTCAAAAGTTTTCAACAGGCAGCAAAGGAGTTTGAAACCGAGTTAAAAAAGGAGCCAG
AAGCCTCTGTTGATCCCCCTGTCGAAAAGGCCATAGAGGTTAGTCAAGAAGAGAAGCAAGATGCAAAGGTTTCAAGCACGAAGGAGAGTT
CATAAAACTACAAATGCAGTTTGCCTCTAGCTATAGCTTGCTAGATTTTATTGTCATACAACATGGTCATTTCTTGTATTTGACTGGTAA
TGTTGAGGTCTTTGTGTTTGCGGTTTCCCTCGTTGACAACTTAAGATTATAACTAGGTAACTTAACCATCCTTAGGTCCGATTGATCA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Petunia x hybrida	Petunia-DevA	all floral organs several	2870	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E523352
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 6 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	1800	TatA_E TatB MttA_Hcf106	10
2	26304	TatA_E TatB MttA_Hcf106	5
5	78246		1
1.1	102724	Bacterial sec-independent translocation protein mttA/Hcf106 - Molecular Function: protein transporter activity (GO:0008565) - Biological Process: protein transport (GO:0015031) Twin-arginine translocation protein TatA/E - Biological Process: protein transport (GO:0015031) - Cellular Component: integral to membrane (GO:0016021) Twin-arginine translocation protein TatB - Biological Process: protein secretion (GO:0009306) - Molecular Function: protein translocase activity (GO:0015450) - Cellular Component: membrane (GO:0016020)	11
2	121894	Twin-arginine translocation protein TatA/E - Biological Process: protein transport (GO:0015031) - Cellular Component: integral to membrane (GO:0016021) Twin-arginine translocation protein TatB - Biological Process: protein secretion (GO:0009306) - Molecular Function: protein translocase activity (GO:0015450) - Cellular Component: membrane (GO:0016020) Bacterial sec-independent translocation protein mttA/Hcf106 - Molecular Function: protein transporter activity (GO:0008565) - Biological Process: protein transport (GO:0015031)	6
5	132096	Twin-arginine translocation protein TatA/E - Biological Process: protein transport (GO:0015031) - Cellular Component: integral to membrane (GO:0016021) Twin-arginine translocation protein TatB - Biological Process: protein secretion (GO:0009306) - Molecular Function: protein translocase activity (GO:0015450) - Cellular Component: membrane (GO:0016020) Bacterial sec-independent translocation protein mttA/Hcf106 - Molecular Function: protein transporter activity (GO:0008565) - Biological Process: protein transport (GO:0015031)	6

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: