Sol Genomics Network

Unigene SGN-U209243

Unigene Basic Information

Unigene ID:	SGN-U209243
Unigene Build:	Petunia hybrida #1
Date:	2004-03-30
Organism:	P.hybrida
Alternative ID:	209243
mRNA sequence:	Length: 622 bp

>SGN-U209243 Petunia hybrida #1 (1 members)
ACGGGGTAATTTAGAAAGGAACTTAGCTGCCTTAGCACGTGCAGCCGCTGTGAAAGTTGCAGAACAAGAACATGTTGTGCCCTTTGCCAA
AGATGTGCAGCGCCTTTCTTCACCACTGTTGGATGGCAAGCTTGCTGAGAGCGCTGAGGTTGAAATGGAAGTTATCCCAATGGGCGTTAA
TAATCATGATATCTCCAGCGCGTTTAGAGTTGCCTCACCTATGGTGGTTGATGAACCTATGCTGGAAAAGGTTCTTGGTCCACCTAGGTA
TGATGACAAAGAAACAGCAGAACGAGTTGCCAATCCTGGTGTATCTGTTGGACTGGTGTGGACATCCTTTGGCGGAGAGGTTCAATTTGT
TGAGGCCACAGCAATGGTAGGAAAAGGTGAACTCCATCTCACTGGCCAACTTGGGGATGTTATCAAAGAATCTGCTCAGATTGCATTGAC
ATGGGTACGTGCCAGAGCCACTGAACTGAAGCTAGCTATTTCTGAAGAAACAAATATTCTAGAGGGCCGGGATATTCACATACATTTTCC
TGCTGGAGCTGTACCTAAGGACGGACCCTCAGCTGGTGTAACCCTGGTTACATCACTGGTTTCATTATTCAGTCAGAGAAGA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Petunia x hybrida	Petunia-PP	all floral organs anthesis	1824	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E528045
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 3 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	1077	26S_p45 Pept_S16_Archaea Pept_S16_lon NACHT_NTPase Peptid_S16_AS Pept_S16_N Peptidase_S16 AAA_ATPase_centr Pept_S16_C	18
2	22918	26S_p45 Pept_S16_Archaea Pept_S16_lon NACHT_NTPase Peptid_S16_AS Pept_S16_N Peptidase_S16 AAA_ATPase_centr Pept_S16_C	18
5	57166	26S_p45 Pept_S16_Archaea Pept_S16_lon NACHT_NTPase Peptid_S16_AS Pept_S16_N Peptidase_S16 AAA_ATPase_centr Pept_S16_C	16
1.1	102269	AAA ATPase central region - Molecular Function: ATP binding (GO:0005524) Peptidase S16 active site - Molecular Function: ATP-dependent peptidase activity (GO:0004176) - Molecular Function: serine-type endopeptidase activity (GO:0004252) - Biological Process: proteolysis (GO:0006508) Peptidase S16 ATP-dependent protease La - Molecular Function: ATP-dependent peptidase activity (GO:0004176) - Molecular Function: ATP binding (GO:0005524) - Biological Process: ATP-dependent proteolysis (GO:0006510) Peptidase S16 lon N-terminal - Molecular Function: ATP-dependent peptidase activity (GO:0004176) - Biological Process: ATP-dependent proteolysis (GO:0006510) Peptidase S16 lon C-terminal - Molecular Function: ATP-dependent peptidase activity (GO:0004176) - Molecular Function: serine-type endopeptidase activity (GO:0004252) - Biological Process: proteolysis (GO:0006508) AAA ATPase - Molecular Function: nucleotide binding (GO:0000166) - Molecular Function: nucleoside-triphosphatase activity (GO:0017111) Peptidase S16 lon protease - Molecular Function: ATP-dependent peptidase activity (GO:0004176) - Molecular Function: serine-type endopeptidase activity (GO:0004252) - Biological Process: proteolysis (GO:0006508)	17
2	119283	Peptidase S16 active site - Molecular Function: ATP-dependent peptidase activity (GO:0004176) - Molecular Function: serine-type endopeptidase activity (GO:0004252) - Biological Process: proteolysis (GO:0006508) Peptidase S16 lon N-terminal - Molecular Function: ATP-dependent peptidase activity (GO:0004176) - Biological Process: ATP-dependent proteolysis (GO:0006510) Peptidase S16 lon protease - Molecular Function: ATP-dependent peptidase activity (GO:0004176) - Molecular Function: serine-type endopeptidase activity (GO:0004252) - Biological Process: proteolysis (GO:0006508) AAA ATPase central region - Molecular Function: ATP binding (GO:0005524) Peptidase S16 lon C-terminal - Molecular Function: ATP-dependent peptidase activity (GO:0004176) - Molecular Function: serine-type endopeptidase activity (GO:0004252) - Biological Process: proteolysis (GO:0006508) Peptidase S16 ATP-dependent protease La - Molecular Function: ATP-dependent peptidase activity (GO:0004176) - Molecular Function: ATP binding (GO:0005524) - Biological Process: ATP-dependent proteolysis (GO:0006510) AAA ATPase - Molecular Function: nucleotide binding (GO:0000166) - Molecular Function: nucleoside-triphosphatase activity (GO:0017111)	17
5	130789	Peptidase S16 active site - Molecular Function: ATP-dependent peptidase activity (GO:0004176) - Molecular Function: serine-type endopeptidase activity (GO:0004252) - Biological Process: proteolysis (GO:0006508) Peptidase S16 lon N-terminal - Molecular Function: ATP-dependent peptidase activity (GO:0004176) - Biological Process: ATP-dependent proteolysis (GO:0006510) Peptidase S16 lon protease - Molecular Function: ATP-dependent peptidase activity (GO:0004176) - Molecular Function: serine-type endopeptidase activity (GO:0004252) - Biological Process: proteolysis (GO:0006508) Chaperonin clpA/B - Molecular Function: ATP binding (GO:0005524) AAA ATPase central region - Molecular Function: ATP binding (GO:0005524) Peptidase S16 lon C-terminal - Molecular Function: ATP-dependent peptidase activity (GO:0004176) - Molecular Function: serine-type endopeptidase activity (GO:0004252) - Biological Process: proteolysis (GO:0006508) Peptidase S16 ATP-dependent protease La - Molecular Function: ATP-dependent peptidase activity (GO:0004176) - Molecular Function: ATP binding (GO:0005524) - Biological Process: ATP-dependent proteolysis (GO:0006510) AAA ATPase - Molecular Function: nucleotide binding (GO:0000166) - Molecular Function: nucleoside-triphosphatase activity (GO:0017111)	9

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: