Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U207240

Unigene Basic Information

Unigene ID:	SGN-U207240
Unigene Build:	Solanum melongena #2
Date:	2004-01-12
Organism:	S.melongena
Alternative ID:	207240
mRNA sequence:	Length: 444 bp

>SGN-U207240 Solanum melongena #2 (1 members)
GTGTGCAATACTAGTACTGCAACTCTCAAATCTTCTTTTTGTTCCTCCCCTAATTCTTTAGGTTCCACTCCAAAGCCCTCTCAACTATTC
CTCCATGGAAAGCGCAACCAAGCATTCAAGGTCTCATGCAAGGTTACCAATAATAATGGTGACCAAAACCAAAATGTAGTTGATACAAAT
TCTGTTGATAGGAGGAATGTGCTTCTTGGTTTAGGAGGTCTGTATGGTGTTGCCAATGCTATACCATTAGCGGCATCGGCTACTCCTATA
CCAGCCCCTAATGCCCCATCTTGTGGTACAGCCACCATATCTGATGGTCCTGAAGTACCCTATACTTGTTGCCCCCCTGGTATGCCAGAA
GATATTAAAAAAATTCCATATTACAAGTTCCCTTTTGCCACTAAGCTCCGTATCCGTCAGCCTGCTCATGCTGTTGATGAGGAG

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
PPO1	polyphenol oxidase precursor 1	polyphenol oxidase

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum melongena	cSML	buds & flowers anthesis-stage flowers, 4-8 week old plants	4031	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E514187
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 1 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	245	Ribosomal_S15	63
2	22273		38
5	56477		38
1.1	101607	Ribosomal protein S15 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) S15/NS1 RNA-binding Ribosomal S13S15 N-terminal - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	61
2	118702		35
5	129174		34

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: