Sol Genomics Network

Unigene SGN-U206579

Unigene Basic Information

Unigene ID:	SGN-U206579
Unigene Build:	Solanum melongena #2
Date:	2004-01-12
Organism:	S.melongena
Alternative ID:	206579
mRNA sequence:	Length: 308 bp

>SGN-U206579 Solanum melongena #2 (1 members)
AAGGCTTTCTTCTTCAGCCGCTCGATCTTCATCGAGCTTCTTCACGAGAAGCTCTTTCACCTTTACCGATGATTCGTCTCCGGCTAGATC
TCCTTCGCCGTCACTAGCCTCTTCGTTTGTCGATCAGACGAGAGGTTTCTCATCTAATTCAGTTTCTCCCGCACATCAGATGGGTTTAGT
CTCAGATCTTCCAGCCACAGTGGCTGCTATTAAGAACCCCAGTTCAAAAATTGTATATGATGACTCCAACCATGAGCGTTATCCACCCGG
TGATCCAAGCAAACGTGCTTTCGCTTACTTTGTCTTGA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum melongena	cSML	buds & flowers anthesis-stage flowers, 4-8 week old plants	4031	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E516479
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	119	ABC1	110
2	24382	Rieske_dom Rieske Rieske_proteo UCR_TM_region	8
5	58421	Rieske_dom Rieske Rieske_proteo UCR_TM_region	8
1.1	101509	ABC-1 Protein kinase-like	95
2	121278	Rieske iron-sulfur protein - Biological Process: electron transport (GO:0006118) - Molecular Function: ubiquinol-cytochrome-c reductase activity (GO:0008121) - Cellular Component: membrane (GO:0016020) - Cellular Component: ubiquinol-cytochrome-c reductase complex (GO:0045285) Ubiquinol-cytochrome c reductase iron-sulfur subunit - Biological Process: electron transport (GO:0006118) - Molecular Function: ubiquinol-cytochrome-c reductase activity (GO:0008121) - Cellular Component: ubiquinol-cytochrome-c reductase complex (GO:0045285) Ubiquinol cytochrome reductase transmembrane region - Biological Process: electron transport (GO:0006118) - Molecular Function: ubiquinol-cytochrome-c reductase activity (GO:0008121) Rieske [2Fe-2S] region - Biological Process: electron transport (GO:0006118) - Molecular Function: oxidoreductase activity (GO:0016491)	7
5	132068	Rieske iron-sulfur protein - Biological Process: electron transport (GO:0006118) - Molecular Function: ubiquinol-cytochrome-c reductase activity (GO:0008121) - Cellular Component: membrane (GO:0016020) - Cellular Component: ubiquinol-cytochrome-c reductase complex (GO:0045285) Ubiquinol-cytochrome c reductase iron-sulfur subunit - Biological Process: electron transport (GO:0006118) - Molecular Function: ubiquinol-cytochrome-c reductase activity (GO:0008121) - Cellular Component: ubiquinol-cytochrome-c reductase complex (GO:0045285) Ubiquinol cytochrome reductase transmembrane region - Biological Process: electron transport (GO:0006118) - Molecular Function: ubiquinol-cytochrome-c reductase activity (GO:0008121) Rieske [2Fe-2S] region - Biological Process: electron transport (GO:0006118) - Molecular Function: oxidoreductase activity (GO:0016491)	6

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: