Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U206505

Unigene Basic Information

Unigene ID:	SGN-U206505
Unigene Build:	Solanum melongena #2
Date:	2004-01-12
Organism:	S.melongena
Alternative ID:	206505
mRNA sequence:	Length: 439 bp

>SGN-U206505 Solanum melongena #2 (1 members)
TTTTTTTTTTTTTTTTTTTTTTTCTGGAAGAAAAAAAAAGGCGGGCGTTTATTTAATATAAAAGTTGGTGAAGACAAGAATTCACCATAT
GAGAATGTAACCTATCCTCTTGATCTAAGAAAATTACGCATACAGATTACAGTCAACAGTGATAAAATAGGAGATCTTTATCATCACTAA
AAGCAATCGTCATACAGGTGCCAAATTCCAAACATGGCAGAGCCAGAACAGACTATTTGATCAGTTGATAAAAGTAATAAATCGAGAGCA
AAGTTGTATTTGTGCCACTAGTCTGCATCCATCTCTTCAAGTGCAGCTTTAGCTGCAGCCTTGGCTTCCTCTAACAGATCAGCAGGAACC
TTCTGATGCTGCCGGTTAGACTCATCACACACCCAACTCATCTCCAGTTCAAATGCCTTGTCCTTTGCCTCATCATGTA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum melongena	cSML	buds & flowers anthesis-stage flowers, 4-8 week old plants	4031	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E515392
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 0 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	99	Peptidase_T1	128
2	22099	Pept_T1_subAlpha Peptidase_T1	67
5	57758	Pept_T1_subAlpha Peptidase_T1	11
1.1	101456	20S proteasome A and B subunits - Molecular Function: threonine endopeptidase activity (GO:0004298) - Cellular Component: proteasome core complex (sensu Eukaryota) (GO:0005839) - Biological Process: ubiquitin-dependent protein catabolism (GO:0006511)	138
2	118543	20S proteasome A and B subunits - Molecular Function: threonine endopeptidase activity (GO:0004298) - Cellular Component: proteasome core complex (sensu Eukaryota) (GO:0005839) - Biological Process: ubiquitin-dependent protein catabolism (GO:0006511) Proteasome alpha-subunit - Molecular Function: endopeptidase activity (GO:0004175) - Cellular Component: proteasome core complex (sensu Eukaryota) (GO:0005839) - Biological Process: ubiquitin-dependent protein catabolism (GO:0006511)	58
5	130681	20S proteasome A and B subunits - Molecular Function: threonine endopeptidase activity (GO:0004298) - Cellular Component: proteasome core complex (sensu Eukaryota) (GO:0005839) - Biological Process: ubiquitin-dependent protein catabolism (GO:0006511) Proteasome alpha-subunit - Molecular Function: endopeptidase activity (GO:0004175) - Cellular Component: proteasome core complex (sensu Eukaryota) (GO:0005839) - Biological Process: ubiquitin-dependent protein catabolism (GO:0006511)	9

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: