Sol Genomics Network

Unigene SGN-U206366

Unigene Basic Information

Unigene ID:	SGN-U206366
Unigene Build:	Solanum melongena #2
Date:	2004-01-12
Organism:	S.melongena
Alternative ID:	206366
mRNA sequence:	Length: 446 bp

>SGN-U206366 Solanum melongena #2 (1 members)
AAACTGACAAGTCTCATTCAACTAAGCATGCAAATTTGTTGTTTCTACCAAGTAGCAAAACGAAAAAACAATATTAATAGAAAACCATAA
GGCAGCAAGGATTCAAAGTTCTACAAATTCACTACTCATCGTCTTCCTCGTCATCGTCATCATTTCCACCAGCTGCGTTCAAAGCATTGA
GTCTCTCGATCAACTTAGCTTTCCTCTCTTCATAGGTCAGCTTCTTAAGGTTGTACCTCTTGTGTGTCTTGGGAGGTTGCTTCTGAGACT
TCTTTGGACTTGGATCTGCACGTATGGCAGCGTGAACCTTCTTGTACATCTCCTCAATGTTGTCTGGCTCAAGATCCGCCTTGATGTACG
AGCTAAAGTGTGACTGATATTTCTCAGGTTCATCTTCCATCAAAATATTCATGTATGCAGCAACATGGCCACCATAGATATACTTG

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
AB001583	ribosomal protein L5

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum melongena	cSML	buds & flowers anthesis-stage flowers, 4-8 week old plants	4031	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E517329
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	587	Ribosomal_L18p Ribosomal_L5euk	31
2	22818	Ribosomal_L18p Ribosomal_L5euk	19
5	56962	Ribosomal_L18p Ribosomal_L5euk	19
1.1	101758	Zinc finger FYVE-type - Molecular Function: zinc ion binding (GO:0008270) Zinc finger FYVE/PHD-type - Molecular Function: zinc ion binding (GO:0008270)	40
2	119267	Ribosomal protein L18P/L5E - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Eukaryotic ribosomal protein L5 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) - Molecular Function: 5S rRNA binding (GO:0008097)	18
5	129613	Ribosomal protein L18P/L5E - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Eukaryotic ribosomal protein L5 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) - Molecular Function: 5S rRNA binding (GO:0008097)	18

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: