Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U205297

Unigene Basic Information 
Unigene ID: SGN-U205297
Unigene Build: Capsicum annuum #1
Date: 2003-12-15
Organism: C.annuum
Alternative ID: 205297
mRNA sequence: Length: 246 bp

>SGN-U205297 Capsicum annuum #1 (1 members)
CTCCAACTCCGGCGGTGAATTTTGAACTTGAACAACAAAGAAGTAACATACACGCGCAGCCGTTGTTCCGGTGACAATGTCGACCGGCTT
TTCATTCTCCTCTTCCACTGCTACGACGTCGTCCGCTTCCGGTTCTAACCCATTTTCCATGGCCTTTCCAAGCCCTAATTCCGCCGCCTC
TGCTCCGTCTTTCGGCTTCCGTAATTCTGCTTCTTCAGCCTCTTCCGCTCCCCCTTTTGGTCTTGG


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E503745
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (5)  
Preceding Unigenes (0)None