Sol Genomics Network

Unigene SGN-U203031

Unigene Basic Information

Unigene ID:	SGN-U203031
Unigene Build:	Capsicum annuum #1
Date:	2003-12-15
Organism:	C.annuum
Alternative ID:	203031
mRNA sequence:	Length: 440 bp

>SGN-U203031 Capsicum annuum #1 (1 members)
GCTCCATTTCTCTCAGATCTTGGTAAAGAAGGAATAAAAAGGATGTCGTGGCAAACATATGTGGATGATCATTTGATGTGTGAGATTGAA
GGTAATCGTCTCACTTCTGCTGCTATCATTGGTCAAGATGGTTCTGTTTGGGCTCAATCTGCTACTTTCCCTCAGTTTAAACCCGAATAG
ATAACAGCCATAATGAATGACTTTGCTGAACCTGGTACACTTGCTCCAACTGGTTTATATCTTGGGGGAACAAAGTATATGGTGATTCAA
GGGGAGGCAGGGGCTGTTATACGCGGCAAGAAGGGTCCCGGTGGCATCACCGTTTAAAAAACTAACCACGCTTTGATCATTGGAATATAT
GACGAACCAATGACTCCTGTTCAGTGTAATATTGATTGTTGAAAGGCTGGGTGACTATCTTATTGAACAGAGTCTCTAAT

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
capa2	profilin, allergen Cap a 2	profilin

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Capsicum annuum	KS01	leave	6599	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E489899
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	535	Profilin_plant Profilin	34
2	22444	Profilin_plant Profilin	29
5	56615	Profilin_plant Profilin	29
1.1	101894	Profilin/allergen - Molecular Function: actin binding (GO:0003779) - Biological Process: cytoskeleton organization and biogenesis (GO:0007010) - Cellular Component: actin cytoskeleton (GO:0015629) Plant profilin - Molecular Function: actin binding (GO:0003779) - Biological Process: actin cytoskeleton organization and biogenesis (GO:0030036)	30
2	118790	Plant profilin - Molecular Function: actin binding (GO:0003779) - Biological Process: actin cytoskeleton organization and biogenesis (GO:0030036) Profilin/allergen - Molecular Function: actin binding (GO:0003779) - Biological Process: cytoskeleton organization and biogenesis (GO:0007010) - Cellular Component: actin cytoskeleton (GO:0015629)	30
5	129225	Plant profilin - Molecular Function: actin binding (GO:0003779) - Biological Process: actin cytoskeleton organization and biogenesis (GO:0030036) Profilin/allergen - Molecular Function: actin binding (GO:0003779) - Biological Process: cytoskeleton organization and biogenesis (GO:0007010) - Cellular Component: actin cytoskeleton (GO:0015629)	30

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: