Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U199466

Unigene Basic Information

Unigene ID:	SGN-U199466
Unigene Build:	Capsicum annuum #1
Date:	2003-12-15
Organism:	C.annuum
Alternative ID:	199466
mRNA sequence:	Length: 479 bp

>SGN-U199466 Capsicum annuum #1 (1 members)
ATCAGAACCATGGACATGTTGAGAATGACGAGTCCTGGCATCCTTTATCTGAGAAGGTTTACAACAGTTTGGATTATGCCACAAAGAAAT
TGAGGTTCACTCTACCCTTCCCCTTGCTGGCATATCCTTTCTACCTGTGGGGTAGAACCCCTGGAAAGAAAGGTTCTCACTTTGATTCAA
ACCAGTGATTTGTTTGTCCCAAGTGAGAAGAAAGATGTGATTACTTCAACTTTGTGCTGGACGGCAATGGCTGCATTTCTCGTGGGTTTG
TCCTTTGTCATGGGTCCTATCCAATTGCTTAAGCTCTATGTCATTCCCTATTGGGGCTTTGTCATGTGGGTGGATATAGTTACCTATTTG
CATTNACATGGCCATGATGATAAACTTCCTTGGTACAGAGGAGAGGAATGGAGTTATCTGAGAGGAGGGCTTACAANGCTTGACCGCGAT
TATGGATGGATCAACAACATCCACCATGA

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
fad	omega-3 fatty acid desaturase	omega-3 fatty acid desaturase

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Capsicum annuum	KS12	Placenta	4279	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E511130
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 1 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	233	Fa_desat	65
2	22149	Fa_desat	54
5	56907	Fa_desat	20
1.1	101541	Fatty acid desaturase subdomain - Biological Process: fatty acid desaturation (GO:0006636) - Cellular Component: membrane (GO:0016020) - Molecular Function: oxidoreductase activity acting on paired donors with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (GO:0016717) Fatty acid desaturase - Molecular Function: oxidoreductase activity (GO:0016491) Fatty acid acyl-CoA desaturase - Biological Process: fatty acid biosynthesis (GO:0006633) - Molecular Function: oxidoreductase activity acting on paired donors with incorporation or reduction of molecular oxygen (GO:0016705)	81
2	118579	Fatty acid desaturase subdomain - Biological Process: fatty acid desaturation (GO:0006636) - Cellular Component: membrane (GO:0016020) - Molecular Function: oxidoreductase activity acting on paired donors with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (GO:0016717) Fatty acid desaturase - Molecular Function: oxidoreductase activity (GO:0016491) Fatty acid acyl-CoA desaturase - Biological Process: fatty acid biosynthesis (GO:0006633) - Molecular Function: oxidoreductase activity acting on paired donors with incorporation or reduction of molecular oxygen (GO:0016705)	50
5	129673	Fatty acid desaturase subdomain - Biological Process: fatty acid desaturation (GO:0006636) - Cellular Component: membrane (GO:0016020) - Molecular Function: oxidoreductase activity acting on paired donors with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (GO:0016717) Fatty acid desaturase - Molecular Function: oxidoreductase activity (GO:0016491) Fatty acid acyl-CoA desaturase - Biological Process: fatty acid biosynthesis (GO:0006633) - Molecular Function: oxidoreductase activity acting on paired donors with incorporation or reduction of molecular oxygen (GO:0016705)	17

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: