Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U199394

Unigene Basic Information

Unigene ID:	SGN-U199394
Unigene Build:	Capsicum annuum #1
Date:	2003-12-15
Organism:	C.annuum
Alternative ID:	199394
mRNA sequence:	Length: 449 bp

>SGN-U199394 Capsicum annuum #1 (1 members)
CTTGCCCCAAATATGGTGATCTCAGGGTTCTTGACCACCTATTGCTGAAAACTCTTTCACTGGTATGGGCATTGGAGCTGCAATGACTGG
TTTGCGTCCAGTTGTTGAGGGAATGAACATGGGATTTCTTCTTCTAGCCTTCAACCAAATATCTAACAATTGCGGTATGCTCCACTACAC
ATCTGGTGGCCAGTTTAAGATACCAATTGTCATCCGAGGTCCTGGTGGAGTTGGTAGACAGCTTGGAGCAGAGCACTCTCAACGCCTTGA
GTCATACTTCCAGTCAATTCCTGGAATTCAGATGGTTGCCTGTTCAACCCCCTACAATGCCAAGGGCTTGATGAAGGCAGCTATCAGAAG
TGATAACCCTGTGATTCTGTTTGAGCATGTTTTGCTCTACAACCTCAAGGAGAGAATTCCAGACGAAGAGTATGTGTTGAATCTTGAAG

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
PDHE1beta	Pyruvate Dehydrogenase E1beta	Enzyme produces acetyl-CoA

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Capsicum annuum	KS01	leave	6599	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E492508
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	132	Transketolase_CR Transketolase_C	101
2	22154	Transketolase_CR Transketolase_C	53
5	57561	Transketolase_CR Transketolase_C	12
1.1	101625	Transketolase C-terminal Transketolase central region Transketolase C-terminal-like	56
2	118698	Transketolase central region Transketolase C-terminal Transketolase C-terminal-like	35
5	130243	Transketolase central region Transketolase C-terminal Transketolase C-terminal-like	11

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: