Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U198960

Unigene Basic Information

Unigene ID:	SGN-U198960
Unigene Build:	Capsicum annuum #1
Date:	2003-12-15
Organism:	C.annuum
Alternative ID:	198960
mRNA sequence:	Length: 493 bp

>SGN-U198960 Capsicum annuum #1 (1 members)
GTTTTTTTTTTTTTTTTTTGGTAAATTTTGACATTTCTCTGAAATTACCACTGAAGAGGTGATCTTGCTGAAATCAATAAACTACACGCA
TGTTCTGCTTACACATTCCAACTGAAGAAACATATAACACCAAAATAGCTTCACAAGAATATAACAAAACTAAAACAAGATCAAACACAG
AATCATTTGAAGTGATTACATACCAGACATCAAAAATAACTACCAGCCTTTACATAAACCCAAAACACCCCCAAAAGATCCCCAAATTAA
AGCCTAAGAGCTAGTGAACTTGGTAACAGCCTTGGTCCCTTCAGAAACAGCGTGCTTAGCCAATTCACCAGGCAANACAAGTCTCACAGG
AGTCTGAATTTCCCTGGAAGTGATAGTAGGCTTCTTGTTGATCCTAGCCAATCTAGATGATTCCTGAGCAAGCTTCTCAAATATATCATT
AATGAAACTGTTCATTATACCCATTGANTTGCTGGAAATGCCG

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
AF038386	histone H2B AF038386

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Capsicum annuum	KS09	Young fruit (0.5-2 cm)	4055	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E502763
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 5 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	261	Hist_TAF Histone_H2B CBFA_NFYB_domain Histone_core_D	59
2	22131	Hist_TAF Histone_H2B CBFA_NFYB_domain Histone_core_D	58
5	56365	Hist_TAF Histone_H2B CBFA_NFYB_domain Histone_core_D	58
1.1	101589	Histone-fold Histone-fold/TFIID-TAF/NF-Y - Molecular Function: DNA binding (GO:0003677) Histone H2B - Cellular Component: nucleosome (GO:0000786) - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634) - Biological Process: nucleosome assembly (GO:0006334) - Biological Process: chromosome organization and biogenesis (sensu Eukaryota) (GO:0007001) Histone core - Molecular Function: DNA binding (GO:0003677)	66
2	118540	Histone-fold Histone-fold/TFIID-TAF/NF-Y - Molecular Function: DNA binding (GO:0003677) Histone H2B - Cellular Component: nucleosome (GO:0000786) - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634) - Biological Process: nucleosome assembly (GO:0006334) - Biological Process: chromosome organization and biogenesis (sensu Eukaryota) (GO:0007001) Histone core - Molecular Function: DNA binding (GO:0003677)	59
5	129029	Histone-fold Histone-fold/TFIID-TAF/NF-Y - Molecular Function: DNA binding (GO:0003677) Histone H2B - Cellular Component: nucleosome (GO:0000786) - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634) - Biological Process: nucleosome assembly (GO:0006334) - Biological Process: chromosome organization and biogenesis (sensu Eukaryota) (GO:0007001) Histone core - Molecular Function: DNA binding (GO:0003677)	58

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: