Sol Genomics Network

Unigene SGN-U197706

Unigene Basic Information

Unigene ID:	SGN-U197706
Unigene Build:	Capsicum annuum #1
Date:	2003-12-15
Organism:	C.annuum
Alternative ID:	197706
mRNA sequence:	Length: 624 bp

>SGN-U197706 Capsicum annuum #1 (2 members)
CTTCCATTGCTATCAAAACCTTCACCGGTCTCCGTCAATCCTCGCCGGAAAACAACACCATTACTCTCTCTAAACCCCTCCTTTCCGGCC
AACCCCACCGTAGGTTACGTATCAATGCTTCAAAATCCAGCCCAAGAGTCACCGGCCGCAACCTCCGTGTTGCGGTGGTTGGCGGTGGTC
CTGCTGGTGGCGCCGCCGCTGAAACACTCGCTAAAGGCGGAATTGAAACGTTCTTAATAGAGCGTAAAATGGATAACTGCAAACCCTGCG
GTGGTGCTATTCCGCTTTGTATGGTGGGGGAATTCGATCTTCCTCTTGATATCATCGACAGAAAAGTTACCAAGATGAAGATGATTTCTC
CATCCAACGTTGCTGTAGATATCGGACAGACATTAAAGCCTCACGAGTATATCGGTATGGTGCGCCGCGAAGTACTCGATGCTTACCTCC
GTGGCCGTGCTGCCGACGCCGGAGCTGCCGTTCTCAATGGCTTGTTTCTCAAAATGGACATGCCGAAAGCCGCGAATGCACCTTACGTTC
TTCACTACACATCGTACGATTCCAAAACTAACGGCGCCGGCGAGAAACGTACTCTCGAAGTTGACGCCGTTATCGGTGCTGACG

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (2)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Capsicum annuum	KS01	leave	6599	1
Capsicum annuum	KS09	Young fruit (0.5-2 cm)	4055	1

mRNA member sequences (2)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (1)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 3 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	1822	GidA_sub Thi4 FAD_pyr_redox NAD_BS Flav_monooxygnse Thioredox_reduct TrkA_N Rng_mnoxygenase Moxy_FAD_binding Gid	10
2	23867	GidA_sub Thi4 FAD_pyr_redox NAD_BS Flav_monooxygnse Thioredox_reduct TrkA_N Rng_mnoxygenase Moxy_FAD_binding Gid	10
5	57936	GidA_sub Thi4 FAD_pyr_redox NAD_BS Flav_monooxygnse Thioredox_reduct TrkA_N Rng_mnoxygenase Moxy_FAD_binding Gid	10
1.1	102037	FAD-dependent pyridine nucleotide-disulphide oxidoreductase Geranylgeranyl reductase plants and cyanobacteria Geranylgeranyl reductase - Biological Process: photosynthesis (GO:0015979) - Biological Process: chlorophyll biosynthesis (GO:0015995) - Molecular Function: geranylgeranyl reductase activity (GO:0045550) Aromatic-ring hydroxylase - Biological Process: electron transport (GO:0006118) - Biological Process: metabolism (GO:0008152) - Molecular Function: oxidoreductase activity (GO:0016491) NAD-binding site Geranylgeranyl reductase plantal and prokaryotic	24
2	119574	Geranylgeranyl reductase - Biological Process: photosynthesis (GO:0015979) - Biological Process: chlorophyll biosynthesis (GO:0015995) - Molecular Function: geranylgeranyl reductase activity (GO:0045550) NAD-binding site FAD-dependent pyridine nucleotide-disulphide oxidoreductase Geranylgeranyl reductase plants and cyanobacteria Aromatic-ring hydroxylase - Biological Process: electron transport (GO:0006118) - Biological Process: metabolism (GO:0008152) - Molecular Function: oxidoreductase activity (GO:0016491) Geranylgeranyl reductase plantal and prokaryotic	14
5	129904	Geranylgeranyl reductase - Biological Process: photosynthesis (GO:0015979) - Biological Process: chlorophyll biosynthesis (GO:0015995) - Molecular Function: geranylgeranyl reductase activity (GO:0045550) NAD-binding site FAD-dependent pyridine nucleotide-disulphide oxidoreductase Geranylgeranyl reductase plants and cyanobacteria Aromatic-ring hydroxylase - Biological Process: electron transport (GO:0006118) - Biological Process: metabolism (GO:0008152) - Molecular Function: oxidoreductase activity (GO:0016491) Geranylgeranyl reductase plantal and prokaryotic	14

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: